Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for Neuronal acetylcholine receptor subunit alpha 5 NACHRA5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... Detailed immunohistochemistry staining and quantification procedures for each marker have been published (6, 16–26) or are in preparation for estrogen receptor alpha (antibody SP1; Thermo Scientific, Waltham, MA) and an antibody (PPG5/10 ...
-
bioRxiv - Neuroscience 2019Quote: ... 5% CO2 and 37°C in neuronal culture medium (Gibco Neurobasal medium supplemented with 1x Gibco B-27 supplement ...
-
bioRxiv - Biophysics 2024Quote: 5×105 HEK293 cells were plated on a 35 mm cell culture dish (Nunc) one day before transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... iMD3 cells were growth in 5%KSR medium (Alpha-MEM (12571-063, Gibco); 5% KSR (10828028 ...
-
bioRxiv - Immunology 2024Quote: ... The cells were then washed in PBS and stained with a mix of secondary antibodies anti-human IgG-Fc-AF647 (1:600) and anti-human IgA-Alpha-Chain-AF488 (1:200) (Thermo Fisher Scientific) for 30 min at 4°C ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cDNA plasmids in pcDNA™4/TO Mammalian Expression Vector were transiently transfected into Expi293F™ cells stably expressing human FHF2b and human SCN1B subunit (polyclonal) background using ExpiFectamine™ 293 Transfection Kits (Gibco,Thermo Fisher Scientific CAT #: A14524). Induction was achieved using Tetracycline (Sigma Aldrich) ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Physiology 2021Quote: ... transferred and blotted with Peroxisome proliferator-activated receptor alpha (PPARα, ab 215270), endothelial nitric oxide synthase (eNOS, sc-376751) and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Thermo Fisher, #10941-1-AP) antibodies as described [65] ...
-
bioRxiv - Neuroscience 2022Quote: ... conditioned neuronal media was diluted and handled according to the protocol of the Human Aβ42 Ultrasensitive ELISA Kit (Invitrogen) followed by colorimetric readout at 450 nm.
-
bioRxiv - Neuroscience 2020Quote: Total RNA from HEK293 cells and human brain prefrontal cortex were isolated with the TRIzol reagent (Ambion) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2020Quote: Human Embryonic Kidney 293 cells (HEK293, ATCC CRL-1573) were grown under standard conditions in DMEM (Gibco) supplemented with 10% FBS (BioConcept) ...
-
bioRxiv - Neuroscience 2023Quote: The human embryonic kidney cells (HEK293 and HEK293T) were maintained in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 15% Fetal Bovine Serum (FBS ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Human MSCs were cultured in alpha Modification of Eagle’s minimal essential medium (αMEM) (Thermo Fisher Scientific) supplemented with 15% FBS (Gemini Bio-Products) ...
-
bioRxiv - Genetics 2023Quote: ... androgen receptor (Invitrogen), PTK2 (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: HEK293 and commercially available Flp-In T-REx HEK293 cells (Invitrogen; R78007) were cultured in DMEM (GIBCO ...
-
bioRxiv - Neuroscience 2020Quote: ... Neuronal plating media containing Neurobasal (Gibco) supplemented with 10% horse serum ...
-
bioRxiv - Neuroscience 2022Quote: ... 1x SM1 Neuronal supplement (Fisher Scientific), 1x GlutaMAX (Fisher Scientific) ...
-
Machine Learning Ensemble Directed Engineering of Genetically Encoded Fluorescent Calcium IndicatorsbioRxiv - Bioengineering 2023Quote: ... warmed Neuronal Basal Media (Invitrogen; 10888022) supplemented with B27 (Invitrogen ...
-
bioRxiv - Bioengineering 2024Quote: ... warmed Neuronal Basal Media (Invitrogen; 10888022) supplemented with B27 (Invitrogen ...
-
bioRxiv - Bioengineering 2024Quote: ... warmed Neuronal Basal Media (Invitrogen; 10888022) supplemented with B27 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: HEK293 and HeLa cells were cultured at 37°C with 5% CO2 in DMEM (Gibco) with 10% heat-inactivated FBS (BioInd) ...
-
bioRxiv - Cell Biology 2019Quote: HEK293 cells were cultured under standard conditions (37°C, 5% CO2) in DMEM medium (Gibco) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells were maintained at 5% CO2 at 37°C in DMEM with glutamine (Invitrogen) supplemented with 10% FBS (Hyclone) ...
-
bioRxiv - Microbiology 2023Quote: ... MRC-5 and HEK293-FT cells were grown in DMEM with GlutaMAX (Thermo Fisher # 10566016). CHO-K1 ...
-
bioRxiv - Bioengineering 2020Quote: ... were cultured in alpha minimum essential media (alpha-MEM, Invitrogen) supplemented with 15% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: ... and transformed into NEB 5-alpha Competent Escherichia coli (High Efficiency, Thermo Fisher Scientific). Plasmids were isolated from individual colonies and sequenced with the universal primers pJET12F and pJET12R (Eurofins) ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells (ThermoFisher Scientific) were cultured in DMEM/F-12 ...
-
bioRxiv - Bioengineering 2022Quote: ... FreeStyle HEK293 cells (ThermoFisher) were used for recombinant S protein production ...
-
bioRxiv - Molecular Biology 2019Quote: ... HEK293 FT cells (ThermoFisher) were co-transfected with plasmids pCMV-dR8.2 dvpr (gag-pol ...
-
bioRxiv - Synthetic Biology 2019Quote: HEK293 cells (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293 cells (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293-FT (Invitrogen # R70007) cells were grown in Dulbecco’s Modified Eagle Medium (ThermoFisher #11965118 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 (Thermo Fisher Scientific) were cultured in DMEM (Dulbecco’s Modified Eagle Medium ...
-
bioRxiv - Biophysics 2023Quote: ... 5 µg/mL human insulin (Gibco), 2 mM L-glutamine (Corning) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cDNA plasmids in pcDNA™4/TO Mammalian Expression Vector were transiently transfected into Expi293F™ cells stably expressing human FHF2b and human SCN1B subunit (polyclonal) background using ExpiFectamine™ 293 Transfection Kits (Gibco,Thermo Fisher Scientific CAT #: A14524). Induction was achieved using Tetracycline (Sigma Aldrich) ...
-
bioRxiv - Bioengineering 2021Quote: ... Alpha-MEM (Gibco, Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5% heat-inactivated fetal bovine serum (HI-FBS; Gibco™), 1% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... and suspended in complete primary neuronal medium consisting of B-27 Plus Neuronal Culture system (ThermoFisher #A3653401) and 1X GlutaMAX (ThermoFisher #35050061 ...
-
bioRxiv - Microbiology 2021Quote: ... 5% A+ human serum and 5% AlbuMAX II (Life Technologies). Gametocyte media was changed daily without the addition of fresh erythrocytes for 14 days following induction ...
-
bioRxiv - Cell Biology 2023Quote: Human embryonic kidney (HEK293) cells were obtained from ATCC and cultured in Dulbecco’s Modified Eagle’s medium (DMEM, Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids were then transfected into human embryonic kidney cells (HEK293-E, National Research Council, Canada) using 293Fectin (Thermofisher). Six days post-transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... subunit A (SDHA, Thermo Fisher, cat # 459200), -succinate dehydrogenase complex ...
-
bioRxiv - Bioengineering 2020Quote: ... Fifty microliter clots were formed from purified fibrinogen using 0.25 U/mL human alpha-thrombin (Fisher Scientific), 2 mg/mL fibrinogen (Enzyme Research Laboratories) ...
-
bioRxiv - Cell Biology 2022Quote: HEK293 cells were cultured at 37°C and 5% CO2 in DMEM (Thermo Fisher Scientific; 11965092) supplemented with 10% FBS (Thermo Fisher Scientific ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... HEK293 cells were maintained at 37°C with 5% CO2 in DMEM media (ThermoFisher Cat #11965118) supplemented with 10% serum (Serum Plus II ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 cells were cultured at 37°C and 5% CO2 in DMEM (Gibco, cat 11965-092) + 10% FBS ...
-
bioRxiv - Cell Biology 2019Quote: Passage 5 EGFP-pMSCs [19] were cultured in minimum essential medium alpha (MEM-α) (Gibco) supplemented with 10% fetal bovine serum (HyClone ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse IgG1 anti-alpha Tubulin Clone B-5-1-2 (1:500, ThermoFisher 32-2500), Rabbit anti-Myc polyclonal (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length human LRRC4B was subcloned and inserted into the pcDNA6-V5-His vector (Invitrogen). FAM19A5 (NM_001252310.1 ...
-
bioRxiv - Neuroscience 2024Quote: ... After blocking supernatant samples from different groups and standards (recombinant human-TREM2-His; Life Technologies) were incubated for 2 h at room temperature (RT ...