Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 3 4 Ethoxy 3 methoxy phenyl 3 thiophene 2 carbonyl amino propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Invitrogen, 16140071), 1% GlutaMAX ...
-
bioRxiv - Immunology 2022Quote: ... and 3% FBS (Invitrogen). Epidermal sheets were separated from the dermis after incubation for 45 min at 37°C in 2.4 mg/ml of Dispase and 3% FBS and the epidermis was further digested for 30 min in PBS containing 1 mg/ml collagenase D ...
-
bioRxiv - Cell Biology 2024Quote: ... QuantStudio 3 (Thermo Fisher) was used for quantification using a standard curve method.
-
bioRxiv - Microbiology 2024Quote: ... and 3% _-glutamine (Gibco). Madin-Darby canine kidney (MDCK ...
-
bioRxiv - Microbiology 2024Quote: ... or TOPO-3 (Invitrogen) for 10 mins ...
-
bioRxiv - Microbiology 2024Quote: DiOC2(3) (Thermo Scientific) exhibits green fluorescence in all bacterial cells at low concentrations ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 % B27 (Gibco, 17504044), 0.1 % Glutamax ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-3-PGK (Invitrogen) was used at a 1:8000 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16, Thermo Fisher Scientific) in a modified SC medium ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on precast NuPAGE Novex 4-12% Bis-Tris Gels in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen). Samples were transferred to 0.45 µm nitrocellulose membrane (0.9 A ...
-
bioRxiv - Cell Biology 2022Quote: ... at 180V on precast either NuPAGE Novex 4-12% Bis-Tris Gels in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen), or NuPAGE™ 3-8% Tris-Acetate gels in NuPAGE™ Tris-Acetate SDS Running Buffer (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were first loaded for 3 min onto the Acclaim PepMap 100 C18 trap column (75 µm x 2 cm, 3 µm material, Thermo Scientific) with 5 µL min-1 of 3.2% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2 mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary neurospheres grown for 3 days (3-4 million cells) were harvested and crosslinked with 0.5% formaldehyde (Thermo Fisher, cat. no. 28908) in 0.1 M DPBS for 5 min at RT with soft agitation ...
-
bioRxiv - Microbiology 2021Quote: Bis-(1,3-Dibutylbarbituric Acid) Trimethine Oxonol (DiBAC4(3)) and Fura Red (both ThermoFisher) were added to cells at a final concentration of 1 μM in RPMI-media ...
-
bioRxiv - Immunology 2020Quote: ... 4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY™-C16, Invitrogen, 1μM, 30min) or kynurenine (Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... TO-PRO-3 Iodide monomeric cyanine nucleic acid stain (Thermo Fisher, cat# T3605) was used to stain DNA.
-
bioRxiv - Genetics 2021Quote: ... RNA was extracted from control and CRISPR-Cas9 targeted Calu-3 cells (N = 3 biological replicates, with 3 technical replicates per experiment per condition) and prepared using Trizol Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was extracted from freshly-dissected n=3 young (3-month-old) or n=3 aged (18-month-old) zebrafish brain in TRIzol (Invitrogen, 15596). Three independent experimental replicates were used for bulk RNA sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Plant Biology 2022Quote: ... with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific)) to test the strength of the interaction.
-
bioRxiv - Plant Biology 2022Quote: ... with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific)) to test the strength of the interaction.
-
bioRxiv - Genomics 2023Quote: ... All nuclei were pooled and stained with DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306). Using a FACSAria III cell sorter (BD Biosciences) ...
-
bioRxiv - Cell Biology 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000015). Viral supernatant was harvested 48h after transfection and filtered through 0.45 µm cellulose acetate filters (Corning 431220) ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Bioengineering 2024Quote: ... VSV-G expression plasmid and pUC19 plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher). The media was changed 6 hours post-transfection and was collected for downstream processing 48 hours post-transfection.
-
bioRxiv - Cancer Biology 2020Quote: ... The medium was changed every 2-3 days and organoids were passaged every 2-4 weeks by dissociation with 1 ml of TrypLE Express (Life Technologies) at 37°C for 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Biochemistry 2023Quote: ... samples were blotted at 100% humidity for 3 s (13°C, 0 s drain time, blot force -3 to +2) with a Vitrobot Mark IV (Thermo Fisher Scientific) and plunged into liquid ethane ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by transfer to a positively charged nylon membrane and then crosslinked with EDC (1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide) at 60°C for 1–2 hours and prehybridized with ULTRAhyb Ultrasensitive Hybridization Buffer (Invitrogen, cat # AM8670). The membrane was then hybridized with 50 pmol mL−1 Biotin-labeled Locked Nucleic Acid-modified DNA probes (designed and synthesized by Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... pTG-Luc and SARS2-COV2 spike expression vector were transfected into HEK 293T cells at the ratio of 3:4:3 using Lipofectamine 3000 transfection reagent (ThermoFisher Scientific, Waltham, MA). Accession IDs of the spike proteins used in the study were ...
-
bioRxiv - Microbiology 2020Quote: ... RNA (∼3 µg) was treated with 2 units turbo-DNase (Invitrogen) in 1X turbo-DNase buffer for 30 min at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1) ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons are washed 2-3 times with Neurobasal-A medium (Gibco) prior to fixation.
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: ... from 2-3 µg of RNA using oligo(dT) (Invitrogen 18418012) as primer ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were washed 3 times with 2 mL DPBS (Gibco), scraped and lysed in 4% SDC buffer (4% sodium deoxycholate ...