Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 3 4 Ethoxy 3 methoxy phenyl 3 thiophene 2 carbonyl amino propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... acidified to pH2-3 by trifluoroacetic acid (Thermofisher, 85183), and desalted with a Pierce C18 spin column (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... and 5ml propionic acid (Acros Organics) were added ...
-
bioRxiv - Microbiology 2023Quote: ... 418 mL propionic acid (Thermo Fisher), 532 mL deionized water] ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Immunology 2022Quote: Caspase-3 activity was determined using EnzChek™ Caspase-3 Assay Kit #2 (Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... (75 mm i.d. 3 2 cm, Acclaim PepMap100 C18 3 mm, 100 A°, ThermoFisher Scientific) and separated over an EASY-Spray column ...
-
bioRxiv - Microbiology 2022Quote: ... per well were distributed in Ibidi® µ-slide 8-well chambered coverslips and stained with 0.8 μM of the membrane specific fluorescent styryl dye N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM4-64; Thermo Fisher Scientific, Waltham, MA, USA) in the presence of 0 μM (control) ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Bioengineering 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass, 3 µg total plasmid) using Lipofectamine 3000 (Thermo Scientific cat. no. L3000015). Media was exchanged after 6 hours and viral supernatant was harvested 48 hours after transfection and filtered through 0.45 μm cellulose-acetate filters (VWR cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Biophysics 2023Quote: ... 7-Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen. USA), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC ...
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 × 10−3 M GlutaMAX supplement (35050061, Gibco), 2 × 10−4 M L-cystine (C7602 ...
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Microbiology 2021Quote: ... and cells were incubated for 3 hours in minimal essential medium (MEM, Life Technology, Catalog # 11095114) supplemented with 1x MEM non-essential amino acids (Gibco) and 1x Antibiotic/Actinomycotic cocktail (Life Technology) ...
-
bioRxiv - Cell Biology 2024Quote: ... A new rabbit serum was raised against mouse ninein, by cloning cDNA encoding mouse ninein (Uniprot Q61043-3, amino acids 1-496) into vector pRSET-A (Invitrogen), to produce a fusion protein with an amino-terminal hexa-histidine-tag ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Neuroscience 2023Quote: FOs from 2 or 3 independent differentiations were fixed using 4% paraformaldehyde (Thermo Scientific) in PBS (Gibco ...
-
bioRxiv - Pathology 2020Quote: ... citric acid (Fisher Scientific, Cat. No. A104-3, Hampton, NH), sodium phosphate (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled to a pH of 7.4 with 5% CO2 in 95% O2 ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled with 5% CO2 in 95% O2 ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled with 5% CO2 in 95% O2 ...
-
bioRxiv - Biochemistry 2023Quote: The panel of synthetic peptide standards and the products of immunoprecipitated heparan-sulfate 6-O-sulfotransferase 1/2/3 (H6ST-1/2/3) in vitro Tyr sulfation assays were analyzed using Proteome Discoverer 2.4 (Thermo Scientific) in conjunction with MASCOT 59 against either a custom database of all (12 ...
-
bioRxiv - Cell Biology 2024Quote: Sodium salt of 3-methyl-2-oxobutanoic acid (KIV; cat # AC189720050) was purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... and 3ml propionic acid (Fisher Scientific #10193190) per litre of medium) ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-desmocollin 2 and 3 (clone 7G6, Thermofisher), 1:100 ...
-
bioRxiv - Cell Biology 2022Quote: ... HSS117872 (Epsin-2) and HSS147867 (Epsin-3) (Invitrogen) on day 2 and 3 (Boucrot et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Passaged every 2-3 days with TrypleE (Gibco).
-
bioRxiv - Microbiology 2021Quote: ... 2% Non-essential amino acids (Gibco), 6% Sodium bicarbonate solution (Gibco) ...
-
bioRxiv - Immunology 2021Quote: ... 2% Non-essential Amino Acids (Gibco), 2.5% 1M HEPES (Gibco) ...
-
bioRxiv - Microbiology 2023Quote: ... 2% non-essential amino acids (Gibco), 1% glutamine (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... on a 4-12% bis-tris gel (Genescript) in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen). The gel was then fixed for 30 min in 10% acetic acid/50% methanol ...
-
bioRxiv - Cell Biology 2021Quote: ... For live imaging of cells as described for fatty acids up-take we treated cells at day 5 of differentiation with BODIPY™ (10μM) C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen). In addition ...
-
bioRxiv - Biophysics 2024Quote: ... and 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydro (EDC, ThermoFisher). For BS3 crosslinking ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Microbiology 2021Quote: ... siDDX42-4: 5’-AUCUCGAAUACCCUUUACG-3’ (ID:136410, Ambion®).
-
bioRxiv - Microbiology 2023Quote: 3’(4-Hydroxyphenyl)-fluorescein (HPF; Molecular Probes, OR, USA) was used for detecting •OH production (Avci et al. ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... 3-(N-morpholino)propanesulfonic acid) (MOPS) was purchased from Acros Organics. Texas Red DHPE (TR-DHPE) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Indole-3-acetic acid (IAA) was purchased from ThermoFisher (Product #I3750). IAA treatment was performed as previously described (Zhang et al ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Immunology 2022Quote: ... 3 µl of Dynabeads MyOne Carboxylic Acid (1 μm; ThermoFisher Scientific) were added at a concentration of 0.5 mg/ml to each of the samples ...
-
bioRxiv - Bioengineering 2024Quote: ... we neutralized acid-extracted Collagen I (3 mg/ml, Gibco, A1048301) using 10X DMEM and 2N NaOH ...
-
bioRxiv - Biophysics 2020Quote: ... hexanoyl)-2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphoethanolamine) (Invitrogen). Cleavage of PED-6 eliminates a self-quenching effect that results in the release of a BODIPY-FL dye ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...