Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 3 4 Ethoxy 3 methoxy phenyl 3 thiophene 2 carbonyl amino propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... and 3 µL of tris(2-carboxyethyl)phosphine (Thermo Fisher Scientific) to 30 µL of sample ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were passaged every 2-3 days using Accutase (Thermo Fisher). For experiments about 5000 cells were seeded per dish ...
-
bioRxiv - Biophysics 2023Quote: ... 3 µL of 2% 0.2 µm carboxylated FluoSpheres (Invitrogen, Carlsbad, CA), 20 µL of 20 mM Lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were loaded with 3 µM of Fura-2 AM (Invitrogen) in extracellular solution (ECS ...
-
bioRxiv - Immunology 2023Quote: ... MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) (Thermo Fisher) assay was performed by incubating the cells with 50 µg/µl MTT (5 mg/ml stock ...
-
bioRxiv - Neuroscience 2023Quote: ... plates were rinsed with 2-3 ml of PBS (Gibco, #10010023) and treated with 0,5 mL ReLeSR (Stemcell technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 and 3 using the EVOS XL core microscope (Life Technologies).
-
bioRxiv - Cancer Biology 2024Quote: ... PMD2.G at 3:2:1 using Lipofectamine 2000 (Invitrogen, USA). The viral particles were harvested 48 and 72 hrs post-transfection and filtered through a 0.45µm filter ...
-
bioRxiv - Biophysics 2024Quote: ... We passaged cells every 2–3 days using Accutase (Thermo Fisher).
-
bioRxiv - Immunology 2021Quote: ... PBMCs were incubated for 20 min at 37°C in PBS containing 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16; 1 μM; Thermo Fisher Scientific). To determine neutral lipid content ...
-
bioRxiv - Developmental Biology 2020Quote: ... ES cells were passaged every 3–4 days using Accutase (Thermo Fisher) and used to passage 30 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 nl solution of 3 μM FM 4-64 (Molecular Probes, Invitrogen) dissolved in DMSO was injected in the otic cavity of 96 hpf zebrafish embryos mounted laterally in low gelling agarose (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 nl solution of 3 μM FM 4-64 (Molecular Probes, Invitrogen) dissolved in DMSO was injected in the otic cavity of 96 hpf zebrafish embryos mounted laterally in low gelling agarose (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... blotted for 3–4 s in a Vitrobot Mark IV (Thermo Fisher) at 15 °C and 100% humidity ...
-
bioRxiv - Microbiology 2020Quote: ... PobA activity was inhibited with methyl 4-hydroxy-3-iodobenzoate (Fisher Scientific) at a saturating concentration (0.48 mM) ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons were grown for 3-4 days in Neurobasal medium (Thermo Fisher) supplemented with 2% FBS (HyClone) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... samples were diluted 3:1 in 4× NuPAGE LDS sample buffer (Invitrogen) supplemented with 10% beta-mercaptoethanol (v/v) ...
-
bioRxiv - Microbiology 2020Quote: ... at 4 °C for 3 h on a Labquake rotator (ThermoFisher Scientific). The beads were washed with 1 mL cold lysis/binding buffer four times at 300 g for 4 min at 4 °C ...
-
bioRxiv - Biophysics 2021Quote: ... Stained cells were cytospun (Thermo Scientific Cytospin 4 1000rpm for 3 minutes) onto 1.5 thickness coverslips and mounted with ProLongTM Gold mounting medium (Molecular Probes #P36934 ...
-
bioRxiv - Cell Biology 2022Quote: ... in 4:3:1 ratio into 293FT cells (Thermo Fisher Scientific, #R70007) with Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... iPSC-neurons were incubated with 3 µM Fluo-4 (Life Technologies #F14201) at 37°C for 20 min and imaged directly following washout on an LSM Zeiss 880 inverted confocal microscope using a 63×oil 1.4 numerical aperture objective and a 488-nm argon ion laser ...
-
bioRxiv - Neuroscience 2024Quote: ... Invitrogen) and DiD (1,1’- Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt; Invitrogen) crystals were inserted under a stereo fluorescence microscope (MZ10 F ...
-
bioRxiv - Genetics 2023Quote: ... Cultures were passaged enzymatically every 3-4 days using 0.25% Trypsin (Gibco) diluted 1:3 in 1X PBS (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 500 µM 3-isobutyl-1-methylxanthine (Thermo Scientific, Cat # 28822-58-4), 1 µM dexamethasone (Thermo Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were passaged every 3 to 4 days using Accutase™ (Gibco) for up to 10 passages.
-
bioRxiv - Cancer Biology 2023Quote: ... in a 4:3:1 mass ratio with Lipofectamine 2000 (Invitrogen # 11668019) in a 2:1 ratio of Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3-4 or 5-6 and Phusion DNA polymerase (Thermo Fisher Scientific). The resulting PCR mix was DpnI digested and 4 μl of the mix was used for transformation of E ...
-
bioRxiv - Biochemistry 2020Quote: ... The fluorogenic probe 7-diethylamino-3-(4’-maleimidylphenyl)-4-methylcoumarin (abbr. CPM, ThermoFisher, Cat# D346) in 100% DMSO was then added to both quench the enzymatic reaction and react with CoASH to yield the fluorescent CPM-SCoA complex for fluorescence quantification 27 ...
-
bioRxiv - Neuroscience 2024Quote: The FM™ 1-43 (N-(3-Triethylammoniumpropyl)-4-(4-(Dibutylamino) Styryl) Pyridinium Dibromide) (Invitrogen) membrane probe was used to identify actively firing neurons and to investigate mechanisms of activity-dependent vesicle cycling ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR targeting PTPRZ1 (5’-ACTCTGAGAAGCAGAGGAG-3’ and 5’-CTGTTGTCTGTAGTATCCATTAG-3’) or GAPDH (5’-TCAAGGCTGAGAACGGGAAG-3’ and 5’-CGCCCCACTTGATTTTGGAG-3’) was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659) in three technical replicates.
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... while 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine-5,5′-disulfonic acid (DilC18) was purchased from Invitrogen. All stock solutions were prepared in chloroform/methanol (2:1 ...
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Genomics 2024Quote: ... fixed in freshly made fixative [3:1 methanol:acetic acid (Fisher Scientific, Waltham, MA, USA)] ...
-
bioRxiv - Neuroscience 2024Quote: Worms were exposed to 20 mM DL-3-hydroxybutyric acid sodium salt (Acros Organics) on NGM agar plates seeded with E ...
-
bioRxiv - Immunology 2021Quote: ... + 2 mM Glutamax + 1x non-essential amino acids (Gibco) + 57µM β-Mercaptoethanol (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mL of non-essential amino acids (NEAA) (Gibco), and 400 uL of beta-mercaptoethanol (Life Technologies).
-
bioRxiv - Physiology 2024Quote: ... 2-amino-5-methoxybenzoic acid 1 M (ThermoFisher Scientific) in DMSO ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Molecular Biology 2021Quote: ... counted and reseeded in 3 mL A medium (1:3 mix DMEM/F12 (Gibco) and Neurobasal (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl were sampled on a 3 well Diagnostika slides (X1XER303B) from Thermo scientific for observation on an Zeiss LSM710 confocal microscope equipped with a Plan-Apochromat 63×/1.4 Oil objective and 405 nm and 488 nm lasers ...
-
bioRxiv - Microbiology 2023Quote: ... 3′RNA-seq libraries were analyzed on a Qubit 3 Fluorometer (Thermo Fisher Scientific) and an Agilent 4200 TapeStation System prior to paired- end sequencing using the HiSeq 2500 system (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 μg DNA and 3 μL Lipofectamine in 300 μl Optimem (Thermofisher Scientific, USA) were used per well containing 700 μl DMEM ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mg of solid red DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, Molecular Probes) dissolved in methylene chloride were mixed with 50 mg of tungsten beads (1.3 microns in diameter ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...