Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... HEPES ((4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)) was obtained from Fisher Scientific (Pittsburg, PA). Peptides were reconstituted at 25 mg ml-1 in nuclease-free ultra pure water as per the manufacturer’s instructions and stored as aliquots at -20°.HP1α was reconstituted (0.5 mg ml-1 ...
-
bioRxiv - Physiology 2024Quote: ... were aspirated using a 21-gauge needle attached to a 5 mL disposable syringe in the presence of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-buffered TCM-199 medium (Gibco, Life Technologies, Milan, Italy) and 0.005% (w:v ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Physiology 2024Quote: ... 25 μM Cy5-hydrazide with 10 mM 2-amino-5-methoxybenzoic acid (ThermoFisher Scientific) in 1xPBS as a catalyst was added to the cells for 15 minutes at room temperature to allow complete conjugation with the aldehyde ...
-
bioRxiv - Neuroscience 2021Quote: ... the Ca+2 indicator Fluo-4-AM (Molecular Probes, Eugene, OR; 2–5 µl of 2 mM dye) were dropped over S1 cortex ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pseudonana expressing VHAB-eGFP were incubated with the acidotropic pH stain 2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-aminocarbamoyl)methoxy)phenyl)oxazole (PDMPO) (LysoSensor YellowBlue DND-160; Life Technologies) at a final concentration of 0.125 μM without washing in F/2 ...
-
bioRxiv - Cell Biology 2024Quote: ... experiments were grown overnight in SDC at RT and then diluted in SDC and grown at 30°C for >4 h before being treated with either 500 µM 3-indole acetic acid (3-IAA; AID) for 1h or 1 µM estradiol + 1 µM 5-phenyl-IAA (5-Ph-IAA; Fisher Scientific) for 2h (grAID ...
-
bioRxiv - Developmental Biology 2021Quote: Embryos and larvae from 9 hpf to 4 wpf were incubated in 3 µM 5-Ethynyl-2′-deoxyuridine (EdU; ThermoFisher Scientific, cat#: C10639) in FSW for 15-30 min ...
-
bioRxiv - Microbiology 2020Quote: ... washed in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Thermo Fisher Scientific, Waltham, MA, USA) two times ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 ml of 1 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Life Technologies). Sf9 insect cells (ATCC CRL-1711 ...
-
bioRxiv - Bioengineering 2022Quote: ... HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) 1 M was purchased from Gibco (Waltham, MA), sodium chloride 5 M was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Medium was changed every 2-3 days and cells were passaged every 3-4 days using Versene (ThermoFisher) and medium supplemented with Y-27623 ROCK inhibitor (Tocris) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Plant Biology 2020Quote: ... 5-fluoroorotic acid (Fisher Scientific), adenosine-5′-monophosphate disodium (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% nonessential amino acids (Gibco), and 10% FBS (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... on a 4-12% bis-tris gel (Genescript) in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen). The gel was then fixed for 30 min in 10% acetic acid/50% methanol ...
-
bioRxiv - Cell Biology 2021Quote: ... For live imaging of cells as described for fatty acids up-take we treated cells at day 5 of differentiation with BODIPY™ (10μM) C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen). In addition ...
-
bioRxiv - Cell Biology 2024Quote: Sodium salt of 3-methyl-2-oxobutanoic acid (KIV; cat # AC189720050) was purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... resuspended in pre-sort buffer containing 3-5 nM SYTOX Green Nucleic Acid Stain (Thermo Fisher Scientific), and incubated for 20 min at 4°C ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... and 3 mL acid phenol:chloroform (Thermo Fisher). This mixture was heated to 65°C and shaken at 1400 rpm for 10 minutes followed by 5 minutes on ice ...
-
bioRxiv - Immunology 2022Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Immunology 2023Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Immunology 2024Quote: ... and valproic acid (3 mM, Acros Organics). The DNA/FectoPro amount was scaled proportionally depending on the size of the transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Thermo Fisher Scientific, Cat. no. 15630-080,) and 1% penicillinstreptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.1 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (pH = 8.5) (ThermoFisher Scientific, Waltham, MA), 4-benzoylbenzyl-trimethylammonium chloride (PLPP ...
-
bioRxiv - Genomics 2024Quote: ... and lacking sodium pyruvate and HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (McCoy‘s 5A, Gibco 16600082), supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Bioengineering 2020Quote: ... Bodipy FL c16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Thermofisher) was diluted in sterile RPMI-1640 (Corning ...
-
bioRxiv - Immunology 2024Quote: 50 000 enriched CD11b+ LCs were seeded and incubated for 10min at 37°C with 2mM Bodipy-C11 (581/591) (4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-undecanoic acid; Invitrogen) in PBS ...
-
bioRxiv - Bioengineering 2023Quote: ... The concentrated virus was diluted 1:5 in hepatocyte medium containing N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid buffer (HEPES; 20 mM; Gibco) and 4 μm/mL polybrene (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... permeabilised with 0.5% Triton x-100 and OPP incorporation into newly synthesised peptides was measured by conjugating with Alexa647-azide via a Click-IT chemistry reaction (2 µM Alexa-647-azide, 2 mM CuSO4, 5 mM ascorbic acid in PBS) (Invitrogen) and assessing fluorescence by flow cytometry.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2023Quote: FOs from 2 or 3 independent differentiations were fixed using 4% paraformaldehyde (Thermo Scientific) in PBS (Gibco ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Lot 134874), and 4-(2-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, purity ≥ 99.%, CAT #BP310-1, Lot 052975) were from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 μg/mL ascorbic acid (Gibco), and 2.16 g/mL β-glycerolphosphate (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... in 5% acetic acid (Thermo Fisher) to ensure uniform loading ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...