Labshake search
Citations for Thermo Fisher :
2301 - 2350 of 10000+ citations for SARS CoV 2 Spike Glycoprotein S1 Sheep Fc Tag HEK293 Horseradish Peroxidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Lin+ cells were depleted using sheep anti-rat IgG immunomagnetic beads (Dynabeads, Invitrogen). 8-10 x 106 Lin-depleted BM cells from CD45.1 congenic mice were retro-orbitally injected into 6-8-week-old lethally irradiated (1200 rads ...
-
bioRxiv - Microbiology 2023Quote: ... and plated on TSA with 5% sheep’s blood (Fisher Scientific, #221261, Hampton, NH) or 1X TSB (Becton ...
-
bioRxiv - Microbiology 2023Quote: ... and grown on TSA with 5% sheep’s blood (Fisher Scientific, #221261, Hampton, NH) to determine the number of microbes added to the ALI cultures.
-
bioRxiv - Microbiology 2024Quote: ... anti-sheep Alexa Fluor 568 conjugated secondary antibody (Invitrogen, A-21099; 1:1000), anti-mouse Alexa Fluor 568 conjugated secondary antibody (Invitrogen ...
-
bioRxiv - Systems Biology 2020Quote: ... 250ng of doublestranded genome repair DNA fragment (Life Technologies, Table S1, sequence A9) was cotransformed ...
-
bioRxiv - Cancer Biology 2021Quote: ... utilizing the Power SYBR™ Green PCR Master mix (ThermoFisher Scientific, Table S1). Target genes were normalized to beta actin mRNA expression ...
-
bioRxiv - Microbiology 2020Quote: ... S1 proteins were pre-biotinylated using EZ-Link NHS-PEG4-Biotin (ThermoFisher Scientific). Following 20 minutes of pre-hydration of SA biosensors and 1 minute of sensor check ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nuclei were subsequently treated with either 20 U/mL S1 endonuclease (Invitrogen, 18001016) to induce DSBs at sites of DNA gaps or mock-treated (S1 buffer ...
-
bioRxiv - Bioengineering 2019Quote: ... and custom-designed qRT-PCR primers (Table S1; Life Technologies, Grand Island, NY). Transcript levels were normalized to GAPDH and gene expression was calculated as fold-change using the comparative CT method (63).
-
bioRxiv - Molecular Biology 2021Quote: ... While 50 nM of SMART pool siRNAs (Thermo Scientific, Lenexa, Kansas, Table S1) were added to 250 μl of Opti-MEM (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Renca-CAIX cells (Table S1) were cultured in base medium (RPMI1640 (Gibco) supplemented with glutamine (2 mM ...
-
bioRxiv - Biochemistry 2023Quote: ... enterica WbaP were collected on a Titan Krios G3i (Thermo Scientific, Table S1) equipped with a K3 camera (Gatan ...
-
bioRxiv - Molecular Biology 2023Quote: Transfection of expression plasmids (Supplemental Table S1) was performed with Lipofectamine 2000 (Invitrogen) and Opti-MEM (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pellet was washed with 1xPBS and treated with S1 nuclease (Thermo Fisher) at 37°C for 30 min with occasional tapping at 10-minute intervals ...
-
bioRxiv - Biochemistry 2020Quote: ... Each sample was labeled for 2 h at 22°C with a different TMT-tag obtained from a TMT10plex kit (Thermo Fisher Scientific), and then quenched (0.27% hydroxylamine ...
-
bioRxiv - Immunology 2021Quote: ... NC_045512.2 with N-terminal signal peptide and C-terminal thrombin cleavage site-TwinStrep-8xHis-tag) were expressed in Expi293F (Thermo Fisher Scientific) cells at 37°C and 8% CO2 ...
-
bioRxiv - Immunology 2020Quote: ... were coated overnight at 4°C with 2 ug/ml of mouse anti-His-tag antibody (Invitrogen cat. #MA1-21315-1MG, Thermo Fisher Scientific) in PBS ...
-
bioRxiv - Biochemistry 2021Quote: SARS-CoV-2 RBD proteins for SPR binding assays (residues 328-531 of S protein from GenBank NC_045512.2 with N-terminal signal peptide and C-terminal thrombin cleavage site-TwinStrep-8xHis-tag) were expressed in Expi293F (Thermo Fisher Scientific) cells at 37°C and 8% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: Peptides were reconstituted in 100ul of 100mM triethyl ammonium bicarbonate (TEAB) and labeling performed as previously described (1, 2) using TMTPro isobaric tags (Thermofisher Scientific, A44520). Briefly ...
-
bioRxiv - Immunology 2021Quote: ... The peroxidase substrate tetramethylbenzidine (TMB; ThermoFisher) was added and the reactions were stopped by adding 50 uL of 1 M sulfuric acid ...
-
bioRxiv - Molecular Biology 2023Quote: ... Secondary antibodies were peroxidase conjugated (Invitrogen) when the signal was generated using ECL Plus (GE Healthcare ...
-
bioRxiv - Immunology 2019Quote: ... The remaining pieces of tissues were further digested at 37°C with shaking at 180 rpm for 45 min in 2% FCS in RPMI (Life Technologies), containing 1 mg/ml collagenase Type 1 (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: HeLa cells (ATCC CCL-2) were incubated in RPMI (Roswell Park Memorial Institute) medium containing 5% FCS (fetal calf serum, Gibco®) in an incubator with 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Serum samples at varying dilutions were incubated for 2 h followed by detection by a goat anti-human Fc-HRP secondary antibody (ThermoFisher Scientific). The plasma concentration of AvFc was calculated by interpolating from a standard curve ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Hamster lungs were homogenized and diluted in Hank’s solution with the addition of 2% FCS and antibiotics (streptomycin sulfate and benzylpenicillin sodium salt, 200 U/ml) (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were resuspended in buffer (PBS/2% FCS/ 1% penicillin/streptomycin) containing a viability dye from the Sytox series (Life Technologies) or DAPI (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... substituted with 10% fetal calf serum (FCS; Capricorn Scientific, Palo Alto, CA, USA) and 2 mM L-glutamine (Invitrogen, Carlsbad, USA), 50 U/ml penicillin/streptomycin (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were transfected with plasmids expressing bRSV N-GFP and P in DMEM supplemented with 2% FCS.16 h post transfection medium was replaced with Leibovitz’s L-15 medium without phenol red (Gibco, ThermoFisher Scientific), and imaged live with a Leica TCS SP8 confocal microscope using a 63× oil immersion objective ...
-
bioRxiv - Immunology 2023Quote: ... in PBS for 10 min prior to addition of the relevant surface marker fluorochrome-conjugated antibodies in FACS buffer (PBS, 2% heat-inactivated FCS) supplemented with Super Bright staining buffer (Thermo Fisher). Following 30 min of incubation ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Rspo3-Fc Fusion Protein Conditioned Medium (Immunoprecise, #R001-100ml, 2%)] and mixed with 50 µl Matrigel (Fisher Scientific, #CB-40230C). Human alveolar organoid media was refreshed every 3 days until the end of the experiment ...
-
bioRxiv - Immunology 2021Quote: ... Biotinylated Spike or RBD were expressed in 1L of HEK293F cells (Invitrogen) at a density of 1.5 × 106 cells/mL ...
-
bioRxiv - Immunology 2021Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion, Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Immunology 2021Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion, Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We used the ERCC RNA Spike-In Mix (Thermo Fisher Scientific 4456740) in library preparation ...
-
bioRxiv - Immunology 2022Quote: ... The spike probes were purified with HisPur Ni-NTA Resin (Thermo Fisher) as described in the Protein purification section ...
-
bioRxiv - Genomics 2019Quote: ... We added External RNA Control Consortium (ERCC) spike-in controls (Life Technologies) to one microgram of total RNA ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.15 μL ERCC RNA Spike-In Mix (100.000x diluted) (Thermo Scientific, 4456740), 0.15 μL nuclease-free water (NF H2O ...
-
bioRxiv - Microbiology 2020Quote: ... Spike cDNA was produced from the total RNA using superscript iii (ThermoFisher) with specific RT-primers (CAATTGTGAAGATTCTCATA) ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.4 ng spike-in mix was added into the TRIzol (ThermoFisher, 15596018) cell lysis to eliminate technical errors retained during the steps of biotinylating ...
-
bioRxiv - Neuroscience 2022Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion,Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Developmental Biology 2022Quote: ... a 1:4,000,000 dilution of ERCC spike-in transcripts (Life Technologies, #4456740) was added to each sample ...
-
bioRxiv - Immunology 2021Quote: ... NVX-CoV2373 Spike protein was coated on Maxisorp ELISA plate (Thermo Fisher), and then blocked with 5% BSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... we included Spike-In Mix 1 (1:1000; Life Technologies, Cat# 4456740), as from the Fluidigm manual ...
-
bioRxiv - Microbiology 2021Quote: ... Commercially available polyclonal IgG anti-Spike protein antibody (Thermo Fisher, MA5-35949) or anti-fd bacteriophage antibody (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion,Life Technologies) (1:24000000 dilution) ...
-
bioRxiv - Immunology 2020Quote: ... External RNA controls consortium (ERCC) RNA spike-in mixes (Thermo Fisher, 4456740) were included for quality assurance ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1 μl ERCC RNA Spike-In Mix (107 dilution, #4456740, ThermoFisher). After briefly spinning ...
-
bioRxiv - Genetics 2019Quote: Absolute expression analysis used the ERCC spike-in sequences (Ambion, Life Technologies). The analysis used total read counts (not Informative Read counts ...
-
bioRxiv - Genetics 2019Quote: Absolute expression analysis used the ERCC spike-in sequences (Ambion, Life Technologies). The analysis used total read counts (not Informative Read counts ...
-
Evolutionarily divergent mTOR remodels the translatome to drive rapid wound closure and regenerationbioRxiv - Developmental Biology 2021Quote: ... 1 μL of 1:200 ERCC RNA Spike-In Mix (Invitrogen, 4456740) was added to each fraction pool and concentration was measured again ...