Labshake search
Citations for Thermo Fisher :
2301 - 2350 of 10000+ citations for Rat Golgi phosphoprotein 3 GOLPH3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Molecular Biology 2019Quote: ... was performed using the TaqMan gene expression assays (EFHA1/Micu2 rat: s235193; EFHA1/Micu2 human: s47976; Hprt1 rat: Rn01527840; Hprt1 human: Hs99999909, Applied Biosystems, Life Technologies, Carlsbad, CA), using a 7900HT Fast Real-Time System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... with a monoclonal antibody against B5 (19C2, rat, 1:1000; (Schmelz et al. 1994)) followed by an Alexa Fluor 647 anti-rat secondary antibody (Invitrogen; 1:1000 in blocking buffer) prior to permeabilization of the cells with detergent ...
-
bioRxiv - Biochemistry 2024Quote: ... the cells were stained with a monoclonal antibody against B5 (19C2, rat, 1:1000 (Schmelz et al, 1994)) followed by an Alexa Fluor 647 anti-rat secondary antibody (Invitrogen; 1:1000 in blocking buffer). Cells were then permeabilized with 0.1% Triton-X/PBS for 3 min ...
-
bioRxiv - Genomics 2020Quote: ... Day 3 SP34 (Invitrogen) with 5 ng/ml BMP4 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’-Diaminobenzidine (Invitrogen, 750118) as a substrate ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM DTT (Invitrogen) and 40 units RNAse OUT (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μM MMC (ThermoFisher) for 6 hours ...
-
bioRxiv - Cell Biology 2022Quote: A 3% agarose (Invitrogen) gel solution was prepared in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-3 (Life Technologies), Dexamethasone (Sigma) ...
-
bioRxiv - Systems Biology 2020Quote: ... QuantStudio 3 qPCR (Thermofisher) with KAPA Library Quantification Kit (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Immunology 2022Quote: ... and 3% FBS (Invitrogen). Epidermal sheets were separated from the dermis after incubation for 45 min at 37°C in 2.4 mg/ml of Dispase and 3% FBS and the epidermis was further digested for 30 min in PBS containing 1 mg/ml collagenase D ...
-
bioRxiv - Neuroscience 2022Quote: ... QuantStudio 3 from ThermoFisher was used ...
-
bioRxiv - Genetics 2024Quote: ... 3% ES-FBS (Gibco), 0.1 mM β-Mercaptoethanol (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... Qubit 3 (Fisher Scientific) and 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... on QuantStudio 3 (ThermoFisher) and data were quantified by the 2-ΔΔCT method.
-
bioRxiv - Biophysics 2023Quote: ... DiIC18(3) stain (Invitrogen). Transferrin from Human Serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mL Trizol (ThermoFisher) was added to 1 mL of cellular PBS suspension in a 15 mL test tube ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Invitrogen, 16140071), 1% GlutaMAX ...
-
bioRxiv - Biophysics 2023Quote: ... 3 mM DDT (Invitrogen), 1.5 µM of primers listed in Supplemental Table S6 ...
-
bioRxiv - Cell Biology 2024Quote: ... QuantStudio 3 (Thermo Fisher) was used for quantification using a standard curve method.
-
bioRxiv - Genetics 2021Quote: ... RNA was extracted from control and CRISPR-Cas9 targeted Calu-3 cells (N = 3 biological replicates, with 3 technical replicates per experiment per condition) and prepared using Trizol Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was extracted from freshly-dissected n=3 young (3-month-old) or n=3 aged (18-month-old) zebrafish brain in TRIzol (Invitrogen, 15596). Three independent experimental replicates were used for bulk RNA sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... ELISA absorbance was measured at 450nm and normalized to total DNA content (SYBRGreen; Invitrogen) using an absorbance/fluorescence microplate reader (BioTek) ...
-
bioRxiv - Immunology 2021Quote: ... Heat-inactivated HSV-1 McKrae strain was used for coating ELISA plates (Nunc Immunosorbent). The affinity of binding of antigen-specific antibodies to the HSV-1 McKrae strain was measured by ELISA plates coated overnight at 4°C with (104 pfu/ well ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plates were coated with 5 μg/ml TciALDO onto ELISA plates (Maxisorp, Thermofisher Scientific) overnight at 4 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-6 ELISA assay was performed on collected media (Affymetrix eBioscience, #88-7066-22).
-
bioRxiv - Physiology 2020Quote: ... The ELISA was read using a filter-based accuSkan FC micro photometer (Fisher Scientific). The limits of sensitivity were > 0.188 ng/ml and > 0.375 ng/ml for MUC5AC and MUC5B ...
-
bioRxiv - Immunology 2021Quote: ... 50 μl/well of 1-Step™ Ultra TMB-ELISA Substrate Solution (ThermoFisher, 34028) was applied and the enzyme-substrate reaction was stopped after six minutes using 50 μl/well sulphuric acid (1 M H2SO4) ...
-
bioRxiv - Microbiology 2020Quote: A 96-well enzyme-linked immunosorbent assay (ELISA) plate (Nunc MaxiSorp, Thermo Fisher Scientific) was first coated overnight with 100 ng per well of purified recombinant protein in PBS buffer ...
-
bioRxiv - Microbiology 2020Quote: A 96-well enzyme-linked immunosorbent assay (ELISA) plate (Nunc MaxiSorp, Thermo Fisher Scientific) was first coated overnight with 100 ng per well of purified recombinant protein in PBS buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Flat bottom 96-well ELISA plates (Nunc MaxiSorp Plates, Thermo Fisher Scientific, Planegg, Germany) were coated with 50 ng/well recombinant 2019-nCoV (COVID-19 ...
-
bioRxiv - Immunology 2022Quote: ... the reaction was terminated with equal volume of ELISA Stop Solution (Thermo Fisher Scientific). Absorbance at 450 nm was read using the BioTek plate reader ...
-
bioRxiv - Immunology 2022Quote: ... the reaction was terminated with equal volume of ELISA Stop Solution (Thermo Fisher Scientific). Absorbance at 450 nm was read using the BioTek plate reader ...
-
bioRxiv - Immunology 2022Quote: ... a 96-well flat-bottom NUNC PolySorp ELISA plate (Thermo Fisher Scientific, cat: 456529) was sensitised with 100 µL of 95 µM Streptavidin (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... was coated on Nunc Maxisorp ELISA plates (Thermo Fisher Scientific, Cat# 44-2404-21) at 2.5 µg/mL final concentration in Sodium Bicarbonate buffer (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2020Quote: 4ug/mL ACE2 in 1xPBS pH 7.4 was coated onto ELISA strips (Thermo Fisher) for 1 hr and then blocked with 3% BSA solution (1x PBS ...
-
bioRxiv - Immunology 2020Quote: ... Cytokine concentrations were measured by ELISA or Luminex Multiplex Assay (Invitrogen Mouse 20-plex). To determine host susceptibility to endotoxemia ...
-
bioRxiv - Biochemistry 2021Quote: ... 150 μL of TMB (1-Strep Ultra ™B-ELISA, ThermoFisher Scientific, Illkirch, France) distributed in each well ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were incubated with 200 μL of TMB-ELISA (Thermo Scientific, Cat. no: 34028) substrate till the appearance of a light blue color and reaction was stopped by transferring 100 μL of this solution to a different 96-well plate containing 100 μL of 1 M H2SO4 ...
-
bioRxiv - Bioengineering 2020Quote: ... and 100 μl dispensed in triplicate into wells of 96-well ELISA plates (Nunc Maxisorp ...
-
bioRxiv - Molecular Biology 2022Quote: ... either 100uL or 20uL supernatant was collected for aldosterone or cortisol competitive ELISA (Invitrogen), respectively ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bound secondary antibody was detected using Ultra TMB One-Step ELISA substrate (Thermo Fisher). After quenching the reaction with sulfuric acid ...
-
bioRxiv - Microbiology 2021Quote: ... each well of a 96-well ELISA plates (Nunc-Immuno 96-well, Polysorp plates) was coated with 1 μg/ml NDO-LID (Natural Octyl Disaccharide-Leprosy IDRI Diagnostic ...