Labshake search
Citations for Thermo Fisher :
2401 - 2450 of 10000+ citations for Rat Golgi phosphoprotein 3 GOLPH3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... Sections were then washed 3×5min in PBS and transferred into 0.05% DAB solution (Life Technologies NeuroTrace BDA kit) for 10 minutes to process the stain ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The assay was performed according to the manufacturer’s protocol using the EnzChek Caspase-3 assay kit (Thermo Fisher Scientific). Briefly ...
-
bioRxiv - Genetics 2021Quote: ... The DNA concentration was measured using a Qubit 3 Fluorimeter and the dsDNA Broad Range Assay kit (ThermoFisher, Q32850)
-
bioRxiv - Physiology 2020Quote: ... and cDNA synthesis was performed with 1 μg of total RNA following the manufacturer’s instructions of the 3’ RACE kit (Invitrogen). Polymerase chain reaction (PCR ...
-
bioRxiv - Microbiology 2021Quote: ... Concentration of DNA was determined using the Qubit dsDNA HS kit and the Qubit 3 fluorometer (Invitrogen/ThermoFisher Scientific). One hundred nanograms of purified DNA sample were sheared with M220 Focused-Ultrasonicator (Covaris ...
-
bioRxiv - Immunology 2021Quote: Sex and age-matched CD4+ T cells were enriched from CD45.1 and naïve control or RorcCre Tet1/3 mice using the Dynabeads untouched CD4 T cell kit (ThermoFisher Scientific), ensuring >85% purity ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The full structure of the NUKU2 transcript was determined with 5’ and 3’ RACE using the GeneRacer kit (Invitrogen), and testicle total RNA (Ambion ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 3’ end RNA was synthesized by in vitro transcription using an mMESSAGE mMACHINE T7 kit (Invitrogen) with a DNA template (5’- TAATACGACTCACTATAGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAAUGACGTAGCATGCTACGCG -3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... was synthesized (Integrated DNA Technologies) and biotin-labeled (Pierce™ Biotin 3’ End DNA Labeling Kit, Thermo Fisher Scientific). The sequence used is as follows ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... blocked for 20’ with hydrogen peroxidase (3%, Alexa Fluor 594 Tyramide SuperBoost Kit, Invitrogen, Thermo Fisher Scientific, Ghent, Belgium), washed twice in 1XPBS for 5’ each and incubated with Goat anti-Rat-Biotin (1:300 ...
-
bioRxiv - Neuroscience 2023Quote: ... Tol2 DNA plasmids containing the 3×UAS:Positron2-Kv gene (synthesized, Epoch) were co-injected with transposase (synthesized using SP6 Transcription Kit, ThermoFisher) into single-cell stage zygotes from Tg(HuC:Gal4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Construction of cDNA libraries from RNA samples was done using the Collibri™ 3′ mRNA Library Prep Kit (Invitrogen). Samples were sequenced on a NextSeq 550 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 days following dissociation and plate down we induced pluripotency via the CytoTune -iPS 2.0 Sendai Reprogramming Kit (Invitrogen), at MOI = 5 for 24 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell numbers were analyzed for 3 days successively using FluoReporter™ Blue Fluorometric dsDNA Quantitation Kit (Invitrogen™, F2962) as per manufacturer’s protocol and fluorescence measurements were taken with a Victor X (PerkinElmer ...
-
bioRxiv - Neuroscience 2024Quote: ... the DNA fragment encoding miRNA for Dsp (5’-TGC TGT TGA GAT GGA CAT CAA TGC ACG TTT TGG CCA CTG ACT GAC GTG CAT TGG TCC ATC TCA A-3’ and 5’-CCT GTT GAG ATG GAC CAA TGC ACG TCA GTC AGT GGC CAA AAC GTG CAT TGA TGT CCA TCT CAA C-3’) was subcloned into pcDNA6.2-GW-EmGFP-miR using BLOCK-iT Pol II miR RNAi Expression Vector Kit (Invitrogen). The EmGFP and Dsp miRNA fragments were amplified by PCR from this vector and inserted between the KpnI and EcoRV sites of the pAAV-EF1α-DIO EYFP vector (#27056 ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Plant Biology 2020Quote: ... The secondary antibody was anti-rat-Alexa 568 (Thermo Fisher, MA) at 1:1000 and DyLight™ 405 goat anti-mouse antibody (BioLegend ...
-
bioRxiv - Cell Biology 2020Quote: ... and GeneChip® Rat gene 2.0 ST array (Affymetrix, ThermoFisher Scientific) were used according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... and GeneChip® Rat gene 2.0 ST array (Affymetrix, ThermoFisher Scientific) were used according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by secondary antibodies (Alexa Fluor Goat anti-Rat 488 Invitrogen #A-11006 ...
-
bioRxiv - Cell Biology 2020Quote: ... Goat anti-rat Alexa 555 (Thermo Fisher Scientific, A21434, 1:400) and Phalloidin Alexa 488 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and Alexa Fluor® 647-conjugated goat anti-rat (Invitrogen, A21247) (1:500) ...
-
bioRxiv - Immunology 2021Quote: ... efluor660-conjugated rat anti-human OCT3/4 (ThermoFisher Scientific, MA, USA), FITC-conjugated mouse anti-human SOX2 (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... and donkey anti-rat Alexa Fluor 594 (1:1000, Life Technologies). The biotinylated secondary antibodies used were ...
-
bioRxiv - Developmental Biology 2022Quote: ... goat anti-rat IgG Alexa Fluor™ Plus 647 (Invitrogen, A21247); goat anti-rabbit IgG Alexa Fluor™ Plus 555 highly cross-absorbed (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... and rat IgG1 kappa isotype control (1:400, Thermo Fisher Scientific). To assess phagocytosis of macrophages in suspension ...
-
bioRxiv - Neuroscience 2021Quote: ... Alexa Fluor 488 goat anti-rat IgG(H+L) (Life Technologies) were added (1:400 ...
-
bioRxiv - Neuroscience 2021Quote: ... and Cy5-conjugated goat anti-rat IgG (Invitrogen, A10525, 1:500). Phalloidin-TRITC (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... and goat anti-rat Alexa Fluor 647 (1:400; Invitrogen #A21247).
-
bioRxiv - Molecular Biology 2021Quote: ... goat anti-rat Alexa Fluor 488 (Invitrogen, 1/1000, cat# A110060) and goat anti-mouse Alexa Fluor 594 (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... and goat Alexa647 Fluor anti-rat IgG (Thermo Fisher Scientific; A21247). Immunostained samples were examined using a laser confocal microscope (LSM700 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rat Skor2 cDNA fragment (GeneArt sequence-based gene synthesis, Life Technologies) was cloned into pBluescript SK+ vector digested with NotI and SalI ...
-
bioRxiv - Developmental Biology 2022Quote: ... -rat or -chicken IgG (Invitrogen, all used at 1:1000 dilution). DAPI (beyotime ...
-
bioRxiv - Genomics 2020Quote: ... E-cadherin (rat, Life Technologies 131900 clone ECCD-2, 1:100), Mucin 1 (Muc1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and anti-rat IgG conjugated with Alexa Fluor 488 (Molecular Probes) at 1:400 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... and Alexa Fluor goat anti-rat 546 (Life Technologies, 1:100). The mouse anti-PfFIKK4.2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Alexa 488/568 anti-mouse/rabbit/rat 1:500 (Life Technologies), fluorescent phalloidin (Life Technologies ...
-
bioRxiv - Bioengineering 2019Quote: ... and goat anti-rat IgG (H+L) (AF680) (Thermofisher, A-21096).
-
bioRxiv - Neuroscience 2019Quote: ... and rat anti-Fili (1:200; custom produced by Thermo Fisher Scientific against a peptide epitope containing Fili residues 684-701 DDEPEHLYERFDHYEYPD) ...
-
bioRxiv - Pathology 2021Quote: ... AlexaFluor-conjugated secondary antibodies raised against Rat or Rabbit IgG (Invitrogen) were used at 1:200.
-
bioRxiv - Cancer Biology 2021Quote: ... for samples without TCB treatment and monoclonal rat anti-CD45 (Invitrogen). After overnight incubation ...
-
bioRxiv - Neuroscience 2020Quote: ... rat anti-CD140b/PDGFRB (Thermo Fisher, 14-1402-82, 1:100).
-
bioRxiv - Cell Biology 2021Quote: ... was incubated with sheep anti-rat IgG magnetic dynabeads (Invitrogen, 11035) in a solution of sterile PBS 0.1%BSA (120ul of beads ...
-
bioRxiv - Cancer Biology 2021Quote: ... secondary goat anti-rat IgG-Alexa 547 (1:1000, Molecular probes) was incubated for 1h at RT ...
-
bioRxiv - Bioengineering 2021Quote: ... and Alexa Fluor 555 donkey anti-rat IgG (Invitrogen, A-48270). Cerebrum secondary antibody solution contained Alexa Fluor 546 donkey anti-mouse IgG (Invitrogen ...