Labshake search
Citations for Thermo Fisher :
2301 - 2350 of 10000+ citations for Oregon Green Dyes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... SYBR Green Power Mix reagent (Applied Biosystems) was used in reactions with a final volume of 12 μl containing 6 μl of SYBR Green Power Mix ...
-
bioRxiv - Immunology 2020Quote: ... and SYBRTM Green Master Mix (Thermo Fisher). Cellular RNAs were normalized to GAPDH levels ...
-
bioRxiv - Cell Biology 2019Quote: ... SYBR green fast master mix (Applied Biosystems) was used for real-time qRT-PCR reactions and data were analysed using an Applied Biosystems 7500fast machine with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen) or Platinum SYBR Green qPCR SuperMix-UDG with ROX (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... using PowerUp SYBR Green Master mix (Invitrogen) for 40 cycles amplification ...
-
bioRxiv - Developmental Biology 2019Quote: ... using SYBR Green PCR Master Mix (Thermofisher). Experiments were performed in biological triplicates with technical triplicates ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Donkey anti-mouse green (SA5-10172, ThermoFisher) and donkey anti-rabbit red (SA5-10042 ...
-
bioRxiv - Microbiology 2019Quote: ... using SYBR Green (Invitrogen, Thermo Fisher Scientific) and GoTaq G2 Polymerase (Promega) ...
-
bioRxiv - Microbiology 2019Quote: ... using SYBR Green (Invitrogen, Thermo Fisher Scientific) and GoTaq G2 Polymerase (Promega) ...
-
bioRxiv - Microbiology 2019Quote: ... using SYBR Green (Invitrogen, Thermo Fischer Scientific) and GoTaq G2 Polymerase (Promega ...
-
bioRxiv - Plant Biology 2020Quote: ... using SYBRTM Green Master Mix kit (ThermoFisher). Primers for qRT-PCR are listed here32 ...
-
bioRxiv - Neuroscience 2021Quote: ... with Power SYBR Green Master Mix (Thermofisher) following manufacturer’s protocols and with 1M betaine in the master mix due to high GC content (72% ...
-
Loss of p32 triggers energy deficiency and impairs goblet cell differentiation in ulcerative colitisbioRxiv - Molecular Biology 2020Quote: ... applying Perfecta SYBR Green Supermix (ThermoFisher Scientific) and 0.5 µM forward and reverse primer ...
-
bioRxiv - Physiology 2020Quote: ... PowerSYBR Green Master Mix (Invitrogen, Carlsbad, CA) was used for qPCR ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 nM mitotracker green (Invitrogen, MA, USA) and 10 nM lysotracker red (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... MitoTracker Green FM (Thermo Fisher Scientific E34250) and ER-Tracker™ Red dye (Thermo Fisher Scientific E34250 ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μL 10x SYBR Green I (Invitrogen) in Lysis buffer (20mM Tris/HCl ...
-
bioRxiv - Genomics 2021Quote: ... and SYBR Green I (ThermoFisher, Catalog #S7563). To determine additional cycles ...
-
bioRxiv - Genetics 2020Quote: ... and Dynamo Flash SYBR GREEN (Thermo Scientific). The Telo-3C interaction frequency was normalized to an intergenic PCR product (primers oRS39 and oRS40).
-
bioRxiv - Genetics 2020Quote: ... using DyNAmo Flash SYBR Green (Thermo Scientific).
-
bioRxiv - Genomics 2021Quote: ... 0.6x SYBR Green I (Life Technologies, S7563), 1x NEBNext High-Fidelity 2x PCR MasterMix ...
-
bioRxiv - Cell Biology 2019Quote: ... and MitoTracker Green (ThermoFisher Scientific, cat. M7514). Fresh fibroblast medium (2 mL ...
-
bioRxiv - Genetics 2021Quote: ... HCS LipidTox green (Thermo Fisher Scientific, # H34350), was applied at a dilution of 1:1000 and incubated overnight at 4°C ...
-
bioRxiv - Genetics 2020Quote: ... 1x SYBR Green I (ThermoFisher Scientific, S7563), Q5 Hot Start DNA polymerase (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 1x SYBR Green I (ThermoFisher Scientific, S7563), Q5 Hot Start DNA polymerase (NEB ...
-
bioRxiv - Genetics 2020Quote: ... Fast SYBR Green Master Mix (Applied Biosystems) was used for qPCRs ...
-
bioRxiv - Genetics 2020Quote: ... and MitoTracker Green (200nM, Thermo Fisher, M7514) according to the manufacturer’s protocol and sorted cells into 3 bins according to their ratio of MitoTracker Red (which stains mitochondria dependent on Δψm ...
-
bioRxiv - Cell Biology 2021Quote: ... using SYBR Green Master Mix (ThermoFisher Scientific). The average gene expression of β-actin (ACTB ...
-
bioRxiv - Cell Biology 2021Quote: ... PowerUp SYBR Green Master Mix (Applied Biosystems) and a QuantStudios5 real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Physiology 2021Quote: ... CellROX Green Reagent (Life Technologies, Carlsbad, USA), at the final concentration of 5 μM ...
-
bioRxiv - Physiology 2020Quote: ... using Fast SYBR Green Master Mix (Invitrogen) and a 7500 Fast Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Physiology 2021Quote: ... SYBR-Green master mix (Thermo Fisher Scientific) assays were used to quantify Symbiodinium ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using SYBR Green Master Mix (Life Technologies) and GoTaq qPCR Master Mix (Promega) ...
-
bioRxiv - Biochemistry 2021Quote: ... in 1X FastDigest Green Buffer (Thermo Scientific) in a volume of 30 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... using SYBR Green (Invitrogen, Carlsbad, CA, USA) and specific primers (Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: ... using SYBR Green detection tools (Applied Biosystems). Expression of each gene was normalized to TATA Box Protein (Tbp ...
-
bioRxiv - Cell Biology 2021Quote: ... with SYBR Green Master Mix (Applied Biosystems). The primer set designed at the C-terminus of act1 was used as the control (24) ...
-
bioRxiv - Developmental Biology 2020Quote: ... PowerUp SYBR Green Mastermix (Applied Biosystems A25741) was used for qPCR to quantify CVB (Forward – CCCCGGACTGAGTATCAATA ...
-
bioRxiv - Genomics 2021Quote: ... using Maxima SYBR Green (K0221; Life Technologies) on the Lightcycler480 (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... 1x Green buffer (Thermo Scientific™, No.), 1 μM ATP (Thermo Scientific™) ...
-
bioRxiv - Plant Biology 2021Quote: ... PowerUp SYBR Green Master Mix (Thermo Scientific) was used with an ABI 7500 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... FastStart Universal SYBR Green Master (ThermoFisher # 4913850001) was used for relative quantification of cDNA on the ViiA 7 Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... and PowerUp SYBR Green mastermix (Applied Biosystems). qRT- PCR was performed on the QuantStudio 7 system (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 25nM Mitotracker Green (Invitrogen cat. no. M7514), and/or 20nM TMRM (Invitrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... DreamTaq Green PCR Master Mix (Thermo Scientific) was used for colony PCR ...
-
bioRxiv - Synthetic Biology 2021Quote: ... DreamTaq Green PCR Master Mix (Thermo Scientific) was used for colony PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... PowerUp SYBR Green Master Mix (Applied Biosystems) was used for qPCR reactions ...
-
bioRxiv - Microbiology 2020Quote: The LipidTOX Red/Green were from Invitrogen. Sodium oleate and lipid strandards were from Sigma ...
-
bioRxiv - Immunology 2020Quote: ... MitoTracker Green (Invitrogen M7514, reconstituted in DMSO) was added directly to cell culture media at a final concentration of 100nM ...
-
bioRxiv - Microbiology 2020Quote: ... SYBR Green PCR Master Mix (Applied Biosystems) was used according to manufacturer’s instructions ...