Labshake search
Citations for Thermo Fisher :
2251 - 2300 of 10000+ citations for Oregon Green Dyes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... and SYBR Green chemistry (ThermoFisher Scientific, Denmark). Real-time PCR was conducted in 20 μL reaction using 1 μL of 1:20-diluted library ...
-
bioRxiv - Synthetic Biology 2022Quote: ... DreamTaq Green PCR Master Mix (Thermo Scientific) was used for colony PCR ...
-
bioRxiv - Synthetic Biology 2022Quote: ... DreamTaq Green PCR Master Mix (Thermo Scientific) was used for colony PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... we used SYBR green reagent (Applied Biosystems), and primer pairs to amplify regions corresponding to our genes of interest (Table 1 below) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μM Calcium Green-5N (Invitrogen). Fluorescence was monitored at 485 nm excitation and at 535 nm emission ...
-
bioRxiv - Neuroscience 2023Quote: ... using qPCR Sybr-Green master mix (ThermoFisher). Samples were run for 40 cycles on a StepOne qPCR apparatus (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... using SYBR Green Master mix (Applied Biosystems). Relative gene expression was quantified by ΔΔCt method and normalized to HPRT1 or GAPDH ...
-
bioRxiv - Neuroscience 2022Quote: ... with PowerUp SYBR Green Mastermix (Applied Biosystems) in the CFX BioRad Real-Time PCR Detection System following its recommended protocols ...
-
bioRxiv - Neuroscience 2022Quote: ... or labeled with MitoTracker Green FM (ThermoFisher) in the soma and MitoTracker Red CMXRos (Thermofisher ...
-
FGF21 has a sex-specific role in calorie-restriction-induced beiging of white adipose tissue in micebioRxiv - Physiology 2022Quote: ... with Sybr Green PCR Master Mix (Invitrogen). Actin was used to normalize the results from gene-specific reactions.
-
bioRxiv - Immunology 2023Quote: ... 5 μM CellROX™ Green (Invitrogen, C10444) and 1 μM MitoSOX™ Red (Invitrogen ...
-
bioRxiv - Pathology 2023Quote: ... with SYBR Green (4309155, Thermo Fisher Scientific), a final concentration of primers of 500 nM and using 2µL of previously diluted cDNA (1:10) ...
-
bioRxiv - Neuroscience 2023Quote: ... LysoSensor Green DND-189 stock solution (ThermoFisher) was diluted to the final working concentration (1 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... using DyNAmo ColorFlash SYBR Green (Thermo Scientific). The gene-specific primer sets were used at a final concentration of 0.2 mM Primers are listed in Supplementary Table 3.
-
bioRxiv - Immunology 2023Quote: ... PowerSYBR Green PCR Master Mix (Applied Biosystems) was used and assays were run on a QuantStudio 6 Pro (Applied Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... and 50 nM Sytox Green (Invitrogen, S7020). Nine fields per well were imaged using the Yokogawa CV8000 automated microscope at 20x magnification ...
-
bioRxiv - Neuroscience 2023Quote: ... Fast SYBR Green Master Mix (Applied Biosystems) was used to perform real-time PCR on a QuantStudio 5 thermocycler (Applied Biosystems) ...
-
bioRxiv - Physiology 2023Quote: ... using a SYBR Green reagent (Life Technologies). Data was then normalized to the ribosomal protein L32 gene expression levels and then normalized to the mean of the control group ...
-
bioRxiv - Neuroscience 2023Quote: pHrodo Green Zymosan Bioparticles (#P35365, Fisher Scientific) were resuspended to 0.5mg/ml in Live Cell Imaging Solution (#12363603 ...
-
bioRxiv - Biochemistry 2023Quote: ... SYBR Green ER SuperMix (Thermo Fisher #11762500) was used during qPCR ...
-
bioRxiv - Biophysics 2023Quote: ... 25 nM SYTOX Green (SxG, ThermoFisher Scientific)) or incubation buffer in our MT experiments (40 mM Tris-HCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... The QPCR SYBR Green Mix (Thermo Scientific) was used for all qRT-PCRs ...
-
bioRxiv - Immunology 2023Quote: ... or PowerUp SYBR Green master mix (ThermoFisher) using a QuantStudio 6 Flex Real-time PCR system (Applied Biosystems ...
-
bioRxiv - Genomics 2023Quote: ... with the addition of SYBR green (Invitrogen), and reactions stopped prior to saturation ...
-
bioRxiv - Genomics 2023Quote: ... 0.5 µL of SYBR green (Life Technologies) and nuclease-free water ...
-
bioRxiv - Neuroscience 2023Quote: Cell permanent Sodium Green tetraacetate (Invitrogen, S6901) was prepared fresh from frozen stock by dissolving in DMSO to 1 mM then diluting in fish water to a final concentration of 10 µM ...
-
bioRxiv - Biochemistry 2023Quote: ... PowerSYBR Green PCR Master Mix (Applied Biosystems), cDNA ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μM Lysosensor Green DND-189 (Invitrogen) was added 3 h prior to microscopy and washed away 10-20 min before visualization of the sample ...
-
bioRxiv - Bioengineering 2023Quote: ... pHrodo Green Zymosan Bioparticles (P35365, Thermo Fisher); Opti-Link Carboxylate-Modified Particles (83000520100290 and W090CA ...
-
bioRxiv - Bioengineering 2023Quote: ... and SYBR Green PowerUp Master Mix (ThermoFisher). Reactions were run in standard mode ...
-
bioRxiv - Cell Biology 2022Quote: DQ-BSA green was purchased from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... SYBR Green PCR Master Mix (Applied Biosystems) was used to perform quantitative PCR (qPCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... or MitoSOXTM Green (Thermo Fisher Sci, M36006) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... quantified by a SYBR green I (Invitrogen) microtiter assay ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sybr Green PCR Master Mix (Thermo Fisher), 5 µM of sense and antisense primers (sequences listed in Resource Table).
-
bioRxiv - Neuroscience 2023Quote: ... Fast SYBR Green Master Mix (Applied Biosystems), and the appropriate primer pairs (Supplementary Table S4) ...
-
bioRxiv - Developmental Biology 2023Quote: ... P53tm1banimals were genotyped using DreamTaq Green (ThermoFisher) as indicated below and the primers are included in (Table 1).
-
bioRxiv - Cancer Biology 2023Quote: ... with SYBR Green Master Mix (Life Technologies). Data processing was performed using ABI QuantStudio™ Software V1.1 (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... stained with Live/Dead green (Life Technologies), and incubated for 30 minutes at 4°C with an antibody cocktail including ...
-
bioRxiv - Microbiology 2023Quote: ... and 2X SYBR Green (Thermo Fisher Scientific) dye was added to each well and incubated in the dark at RT for 30-45 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Power SYBR Green PCR Mastermix (Applied Biosystems) was used to determine relative transcript levels ...
-
bioRxiv - Cancer Biology 2023Quote: ... LysoTracker Green DND-26 (L7526, Invitrogen, Belgium), MitoTracker Green (M7514 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Green (A15882) was acquired from Thermo Scientific. All other products used were from Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... Fast SYBR Green Master Mix (Applied Biosystems) was utilized for the PCR reactions ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR was performed using SYBR green (ThermoFisher) and 5 μM of reverse and forward primers for genes IL-29 (CGCCTTGGAAGAGTCACTCA and GAAGCCTCAGGTCCCAATTC) ...
-
Treg cells drive MYCN-mediated immunosuppression and tumor aggressiveness in high-risk neuroblastomabioRxiv - Cancer Biology 2023Quote: ... SYBR Green PCR master mix (Applied Biosystems) and a Step-One PCR instrument (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... nuclei were visualized with SYTO Green (Invitrogen). Coverslips were mounted using the antifade medium FluorPreserve Reagent (EMD Millipore ...
-
bioRxiv - Immunology 2023Quote: ... and PowerTrack SYBR Green master mix (ThermoFisher), compared with a serially diluted standard of pooled cDNA ...
-
A framework for defining mesenchymal cell types associated with murine periosteal and endosteal bonebioRxiv - Genomics 2023Quote: ... Blue/Green (Thermo Fisher Scientific, catalog # R37609), and manually counted using hemocytometer under EVOS M7000 microscope (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: were assessed by MitoTracker Green (MTG, Invitrogen) and tetramethylrhodamine methyl ester perchlorate (TMRE ...