Labshake search
Citations for Thermo Fisher :
2201 - 2250 of 10000+ citations for Oregon Green Dyes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... using DyNAmo Flash SYBR Green (Thermo Scientific).
-
bioRxiv - Genomics 2021Quote: ... 0.6x SYBR Green I (Life Technologies, S7563), 1x NEBNext High-Fidelity 2x PCR MasterMix ...
-
bioRxiv - Cell Biology 2019Quote: ... and MitoTracker Green (ThermoFisher Scientific, cat. M7514). Fresh fibroblast medium (2 mL ...
-
bioRxiv - Genetics 2021Quote: ... HCS LipidTox green (Thermo Fisher Scientific, # H34350), was applied at a dilution of 1:1000 and incubated overnight at 4°C ...
-
bioRxiv - Genetics 2020Quote: ... 1x SYBR Green I (ThermoFisher Scientific, S7563), Q5 Hot Start DNA polymerase (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 1x SYBR Green I (ThermoFisher Scientific, S7563), Q5 Hot Start DNA polymerase (NEB ...
-
bioRxiv - Genetics 2020Quote: ... Fast SYBR Green Master Mix (Applied Biosystems) was used for qPCRs ...
-
bioRxiv - Genetics 2020Quote: ... and MitoTracker Green (200nM, Thermo Fisher, M7514) according to the manufacturer’s protocol and sorted cells into 3 bins according to their ratio of MitoTracker Red (which stains mitochondria dependent on Δψm ...
-
bioRxiv - Cell Biology 2021Quote: ... using SYBR Green Master Mix (ThermoFisher Scientific). The average gene expression of β-actin (ACTB ...
-
bioRxiv - Cell Biology 2021Quote: ... PowerUp SYBR Green Master Mix (Applied Biosystems) and a QuantStudios5 real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Physiology 2021Quote: ... CellROX Green Reagent (Life Technologies, Carlsbad, USA), at the final concentration of 5 μM ...
-
bioRxiv - Physiology 2020Quote: ... using Fast SYBR Green Master Mix (Invitrogen) and a 7500 Fast Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Physiology 2021Quote: ... SYBR-Green master mix (Thermo Fisher Scientific) assays were used to quantify Symbiodinium ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using SYBR Green Master Mix (Life Technologies) and GoTaq qPCR Master Mix (Promega) ...
-
bioRxiv - Biochemistry 2021Quote: ... in 1X FastDigest Green Buffer (Thermo Scientific) in a volume of 30 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... using SYBR Green (Invitrogen, Carlsbad, CA, USA) and specific primers (Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: ... using SYBR Green detection tools (Applied Biosystems). Expression of each gene was normalized to TATA Box Protein (Tbp ...
-
bioRxiv - Cell Biology 2021Quote: ... with SYBR Green Master Mix (Applied Biosystems). The primer set designed at the C-terminus of act1 was used as the control (24) ...
-
bioRxiv - Developmental Biology 2020Quote: ... PowerUp SYBR Green Mastermix (Applied Biosystems A25741) was used for qPCR to quantify CVB (Forward – CCCCGGACTGAGTATCAATA ...
-
bioRxiv - Genomics 2021Quote: ... using Maxima SYBR Green (K0221; Life Technologies) on the Lightcycler480 (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... 1x Green buffer (Thermo Scientific™, No.), 1 μM ATP (Thermo Scientific™) ...
-
bioRxiv - Plant Biology 2021Quote: ... PowerUp SYBR Green Master Mix (Thermo Scientific) was used with an ABI 7500 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... FastStart Universal SYBR Green Master (ThermoFisher # 4913850001) was used for relative quantification of cDNA on the ViiA 7 Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... and PowerUp SYBR Green mastermix (Applied Biosystems). qRT- PCR was performed on the QuantStudio 7 system (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 25nM Mitotracker Green (Invitrogen cat. no. M7514), and/or 20nM TMRM (Invitrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... DreamTaq Green PCR Master Mix (Thermo Scientific) was used for colony PCR ...
-
bioRxiv - Synthetic Biology 2021Quote: ... DreamTaq Green PCR Master Mix (Thermo Scientific) was used for colony PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... PowerUp SYBR Green Master Mix (Applied Biosystems) was used for qPCR reactions ...
-
bioRxiv - Microbiology 2020Quote: The LipidTOX Red/Green were from Invitrogen. Sodium oleate and lipid strandards were from Sigma ...
-
bioRxiv - Immunology 2020Quote: ... MitoTracker Green (Invitrogen M7514, reconstituted in DMSO) was added directly to cell culture media at a final concentration of 100nM ...
-
bioRxiv - Microbiology 2020Quote: ... SYBR Green PCR Master Mix (Applied Biosystems) was used according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... SYBR Green PCR master mix (Thermo Scientific) was used in qPCR ...
-
bioRxiv - Immunology 2020Quote: ... and amplified using SYBR Green system (ThermoFisher) with beta2 microglobulin as an internal reference gene.
-
bioRxiv - Immunology 2020Quote: ... PowerUp SYBR Green Master Mix (Applied Biosystems), and the CFX384 Real Time PCR System (Bio-Rad) ...
-
bioRxiv - Genetics 2020Quote: ... using the Platinum SYBR Green kit (Invitrogen). Specific primers for mouse leptin and 2 mouse housekeeping genes used for normalization (β-actin and 34B4 mouse genes ...
-
bioRxiv - Neuroscience 2020Quote: ... PowerUp SYBR green master mix (Thermo Fisher), gene-specific forward and reverse primers and run in triplicate on a BioRad CFX96 Touch real-time PCR machine ...
-
bioRxiv - Biochemistry 2020Quote: ... SYBR Green Master Mix (4309155, Applied Biosystems) was used in qRT-PCR with the ABI 7900 machine.
-
bioRxiv - Immunology 2021Quote: ... or SYBR Green® (Thermo Fisher®) as described in the results.
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed using SYBR Green (ThermoFisher) on the StepOnePlus™ instrument (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... with SYBR green fluorescent label (Thermo Fisher). Analyses were performed with the R package MCMC.qpcr version 1.2.4 (Matz et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.25x CellMask Green Plasma Membrane Stain (Invitrogen) was added to the hiPSC-CMs ...
-
bioRxiv - Developmental Biology 2022Quote: ... using SYBR Green Reagent (Thermo Fisher Scientific). Expression levels were normalized to housekeeping genes using ΔΔCT method.
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was stained with SYBR Green (Invitrogen), and images were captured in fluorescence microscope (EVOS Cell Imaging System ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 µM Calcium Green-5N (Thermo Fisher), 0.5 mg/ml BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... MitoTracker Green solution (Life Technologies, Carlsbad, CA) was incubated with the cells for 30 minutes (2D ...
-
bioRxiv - Cell Biology 2022Quote: ... using SYBR Green detection tools (Applied Biosystems). In skeletal muscle tissue ...
-
bioRxiv - Molecular Biology 2022Quote: ... and SYBR-Green I (Thermo Fisher Scientific) at a final concentration of 0.02% vol/vol) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1X SYBR Green PCR Master Mix (ThermoFisher), 500 nM forward primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1X SYBR Green PCR Master Mix (ThermoFisher), 500 nM forward primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... or SYBR Green master mix (Applied Biosystems). TaqMan primer probes or SYBR primer sequences listed below ...