Labshake search
Citations for Thermo Fisher :
2201 - 2250 of 5010 citations for Scyliorhinin II amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... Actin and myosin II were fluorescently labeled with tetramethylrhodamine-6-maleimide (TMR, Life Technologies) and Alexa-647 maleimide (Life Technologies) ...
-
bioRxiv - Biophysics 2023Quote: Recombinant baculovirus was generated by transfecting Sf9 cells with bacmid using Cellfectin II (ThermoFisher). Baculoviruses were harvested from Sf9 cell media by filtering through a 0.22 µm filter and amplified three times before using for cell transduction ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by addition of 8μL of 2.5x SuperScript™ II Reverse Transcriptase buffer (ThermoFisher), 1.5 µl of milliQ water and 0.5 µl of SuperScript™ II Reverse Transcriptase ...
-
bioRxiv - Microbiology 2023Quote: Cell concentration and viability were confirmed using automated cell counter Countess II (ThermoFisher Scientific) with 0.4% trypan blue solution and samples with viability > 70% were further processed ...
-
bioRxiv - Plant Biology 2023Quote: ... was transferred to pMpGWB113 using Gateway LR Clonase II Enzyme mix (Thermo Fisher Scientific).
-
bioRxiv - Plant Biology 2023Quote: ... and then cloned into pGWB513 with GatewayTM LR ClonaseTM II Enzyme Mix (ThermoFisher Scientific) for plant transformation ...
-
bioRxiv - Microbiology 2023Quote: ... 0.5 µL Phusion Hot start II DNA polymerase (2 U/µL, Thermo Fisher Scientific), 36.5 µL nuclease-free water (Promega ...
-
bioRxiv - Genomics 2023Quote: ... 1 M NaCl) and then suspended in 1 × SuperScript II First Strand Buffer (Invitrogen) supplemented with SUPERase•In™ RNase Inhibitor (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... Baculoviruses were produced by transfecting Sf9 cells with the bacmid using Cellfectin II (Invitrogen). After three rounds of amplification ...
-
bioRxiv - Biophysics 2023Quote: ... Baculoviruses were produced by transfecting Sf9 cells with the bacmid using Cellfectin II (Invitrogen). After three rounds of amplification ...
-
bioRxiv - Biophysics 2023Quote: ... The purified bacmid was used to transfect Sf9 cells by Cellfectin II (ThermoFisher Scientific) for baculovirus production ...
-
bioRxiv - Biochemistry 2023Quote: ... Sf21 cells were typically grown in Sf-900 II SFM medium (Thermo Fisher Scientific) at 29 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were ligated into the pCR-Blunt II-TOPO vector (Thermo Fisher Scientific) and sequenced ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were ligated into the pCR-Blunt II-TOPO vector (Thermo Fisher Scientific) and sequenced ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were ligated into the pCR-Blunt II-TOPO vector (Thermo Fisher Scientific) and sequenced ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were ligated into the pCR-Blunt II-TOPO vector (Thermo Fisher Scientific) and sequenced ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were ligated into the pCR-Blunt II-TOPO vector (Thermo Fisher Scientific) and sequenced ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were ligated into the pCR-Blunt II-TOPO vector (Thermo Fisher Scientific) and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.02 U Phusion Hot Start II High-Fidelity DNA polymerase (Thermo Fisher Scientific, USA) and 10-50 ng cDNA ...
-
bioRxiv - Cell Biology 2023Quote: Cells were plated in a Nunc Lab-Tek II chambered cover glass (Thermo Scientific) or a 35-mm cover glass-bottomed dish (MatTek ...
-
bioRxiv - Cell Biology 2023Quote: ... Gateway recombination was performed using Gateway LR Clonase II Enzyme mix (Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2023Quote: ... The collected cells were counted with a Countess II automated cell counter (Thermo Fisher) and examined for viability (samples with >90% viable cells were passed onto scRNA-seq library construction) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR was performed using Phusion Hot Start II DNA polymerase (Thermo Fisher Scientific, F549S) with primers included in Table 1 ...
-
bioRxiv - Genomics 2023Quote: ... gunnari) derived from multiple individuals were isolated using Ultraspec II (Biotecx) or Trizol (Invitrogen) reagent ...
-
bioRxiv - Neuroscience 2023Quote: ... the total cell concentration was measured using the Countess II automated cell counter (Invitrogen), and 5.47*105 cells/cm2 were plated in each well of a poly-D-lysine-coated Seahorse XFe24 V7 PS Cell Culture Microplate (Agilent ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by reverse transcription using the SuperScript II VILO cDNA Synthesis Kit (Invitrogen # 11754050). Expression levels of mRNA were assessed by real-time PCR using the PowerUp SYBR Green Master Mix (Thermo Fisher Scientific #A25743) ...
-
bioRxiv - Molecular Biology 2023Quote: ... qPCR was carried out using TaqMan™ Universal Master Mix II (Thermo Fisher Scientific) and CFX96 detection system (Bio-Rad) ...
-
bioRxiv - Plant Biology 2023Quote: ... the entry vectors were recombined using Gateway™ LR Clonase™ II (Thermo Scientific) with either pGWB642 for the expression of YFP-tagged fusion proteins ...
-
bioRxiv - Neuroscience 2023Quote: Tumor cell concentrations and viability were determined using the Cell Countess II FL (ThermoFisher) prior to calculating cell counts and loading the suspension into the Next GEM Chip G and Chromium Controller (10x Genomics ...
-
bioRxiv - Cancer Biology 2024Quote: ... equipped with an Ion Max source and a HESI II probe (Thermo Fisher Scientific). External mass calibration was performed using the standard calibration mixture every 7 days ...
-
bioRxiv - Synthetic Biology 2024Quote: ... media was removed and cells were counted using the Countess II Cell Counter (ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... cell density was obtained using a Countess II FL cell counter (Thermo Fisher scientific). Samples (100 μL ...
-
bioRxiv - Molecular Biology 2023Quote: ... cell suspension concentration was counted using a Countess II™ Automated Cell Counter (Invitrogen). Parental stocks were obtained from ATCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reactions were performed using the Gateway™ LR Clonase™ II Enzyme mix (Invitrogen) according to manufacturer’s directions.
-
bioRxiv - Cancer Biology 2023Quote: ... and subjected to reverse transcription using SuperScript™ II Reverse Transcriptase (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The PCR reaction was performed with Phusion Hot Start II DNA Polymerase (Thermo Scientific). The DNA concentration was controlled by qPCR with 1x SYBR™ Green I Nucleic Acid Gel Stain (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... The subchondral bone samples were treated with collagenase Type II (Thermo Fisher Scientific, Australia) before washing with 1× PBS 3 to 4 times to remove the debris ...
-
bioRxiv - Microbiology 2023Quote: ... All genes were amplified with Platinum Superfi polymerase II (Thermo Fisher Scientific, Waltham, USA) according to the manufacturer’s instructions by using the following primers for bxdA forward AAGTTCTGTTTCAGGGCCCGATGAGTGAGCGTAAAACGGAT and reverse ATGGTCTAGAAAGCTTTACTAAGTTAACAAAATCCCGGC ...
-
bioRxiv - Genomics 2023Quote: ... cDNA was synthesized with SuperScript™ II Reverse Transcriptase (Invitrogen™ Life Technologies, 18064071) and random primers (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/mL [GIBCO] ...
-
bioRxiv - Microbiology 2023Quote: ... and the Type II MTases M.HpyAI (HP1208) and M.HpyAII (HP1368) were synthesized by ThermoFisher. The sequences of all probes and reporters used can be found in Supplementary Table 2 ...
-
bioRxiv - Genomics 2023Quote: ... cDNA was synthesized with SuperScript™ II Reverse Transcriptase (Invitrogen™ Life Technologies, 18064071) and random primers (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... which were amplified using a proofreading polymerase (Platinum Superfi II DNA Polymerase (Invitrogen #12361010)) using the following thermocycler program: 98°C for 1 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... with 4 mg/mL AlbuMAX™ II Lipid-Rich Bovine Serum Albumin (GIBCO™), 1× MACS NeuroBrew-21 with Vitamin A (Miltenyi Biotec) ...
-
bioRxiv - Pathology 2023Quote: ... containing 1-mg/ml collagenase II (Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA), 10-units/ml DNase I (Sigma–Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... coli-loaded paramecia were counted using an automated cell counter (Life Technologies Countess II) and a final concentration of 2*105 paramecia/mL in E3 medium was used to feed E ...
-
bioRxiv - Neuroscience 2023Quote: ... The coding region was amplified by Phusion Hot Start II HF (Thermo Scientific # F565S) using gene-specific primers with homology arms designed for DNA Assembly ...
-
bioRxiv - Plant Biology 2023Quote: ... One microgram of total RNA was used for reverse transcription (RT; Superscript II, Invitrogen). Transcript levels were quantified by quantitative PCR in a Stratagene MX3005P instrument (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2x Phusion Green Hot Start II High-Fidelity PCR Master Mix (ThermoFisher Scientific, F566) was used to amplify sequences targeted by the sgRNAs ...
-
bioRxiv - Microbiology 2023Quote: ... Sf9 cells were grown in suspension in serum-free Sf-900 II media (Gibco) containing 1x pen-strep in spinner flasks at 27 °C with aeration ...