Labshake search
Citations for Thermo Fisher :
2201 - 2250 of 10000+ citations for Human Procollagen II C Terminal Propeptide PIICP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: cfDNA was extracted from 600 µL of conditioned medium and 100 µL of human/murine plasma using MagMAX Cell-Free DNA Isolation Kit (ThermoFisher Scientific, A29319). The concentration of cfDNA was measured using Qubit dsDNA HS Assay Kit with Qubit 4.0 Fluorometer (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The constructs were used for in vitro transcription and translation using the 1-Step Human High-Yield Mini IVT Kit (Thermo Fisher; 88891) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2024Quote: ... The concentration of hIL-1β and hIL-8 were measured using a human Invitrogen ELISA Kit (Thermo Fisher Scientific, Waltham, MA, USA). All the protocols were used according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: Total secreted HSA concentrations of 72 hr yeast HSA expression cultures were quantified via commercially available Albumin Human ELISA Kit (ThermoFisher Scientific #EHALB), following the included protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... 37 °C in DMEM (Gibco) at pH 7.2 supplemented with 10% fetal bovine serum (Wisent Bioproducts) ...
-
bioRxiv - Biochemistry 2021Quote: ... c-Myc (Applied Biosystems Hs00153408), and 18sRNA (Applied Biosystems Hs 99999901) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... c-myc (13-2500, Invitrogen), Streptavidin-IRDye800 (925-32230 ...
-
bioRxiv - Systems Biology 2022Quote: ... 37 °C in DMEM (Gibco) at pH 7.2 supplemented with 10% fetal bovine serum (Wisent Bioproducts) ...
-
bioRxiv - Microbiology 2022Quote: ... c-Jun (Invitrogen, MA5-15172), SUMOylated c-Fos ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-c-Maf (sym0F1, Invitrogen), CD32b (AT130-2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... C-MET (Fisher Scientific, MAB3729), TFAM (Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... c-Myc (13-2500, Invitrogen), GFP (A11122 ...
-
bioRxiv - Cancer Biology 2023Quote: ... C-MET (Fisher Scientific, MAB3729), TFAM (Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... 37°C incubator (Thermo Scientific) and Molecular Devices Paradigm Multimode reader as previously described47 ...
-
bioRxiv - Biochemistry 2023Quote: ... store at −80° C (Invitrogen)
-
bioRxiv - Bioengineering 2023Quote: ... 4°C DMEM/F12 (Gibco). Crypts were centrifuged at 4°C for 5 minutes again and resuspended again with 300 μL DMEM/F12 medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... and reverse-transcribed using superscript II reverse transcriptase (Invitrogen). The qPCR study was carried out according to the established protocol using SYBR Green master mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2019Quote: ... 8-well Lab-Tek II chambers (Thermo Fisher Scientific). To fix cells ...
-
bioRxiv - Cell Biology 2020Quote: ... and cloned into pCR-Blunt II-TOPO (Thermo Fisher). Correct insertion of the homology arms was then verified by Sanger sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... or Superscript II Reverse Transcriptase (ThermoFisher Scientific, Cat #180644022) following recommended manufacturer protocols ...
-
bioRxiv - Molecular Biology 2021Quote: ... A BP reaction using BP Clonase II (Invitrogen, USA) was performed to clone the insert into pDONR221 (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... cDNA synthesis was performed using the SuperScript II (Invitrogen). Quantitative real-time RT-PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dissociated cells were assessed for viability (Countess II; Invitrogen) and cell-density diluted to 700 cell/µl ...
-
bioRxiv - Developmental Biology 2020Quote: ... and counted using a Countess II FL (Life Technologies). Single cell GEMs and subsequent libraries were then prepared using the 10X Genomics Single Cell V2 protocol with an additional anchor specific primer during cDNA amplification to enrich barcode sequences ...
-
bioRxiv - Plant Biology 2022Quote: ... SuperScript II reverse transcriptase (18064014; Invitrogen, Waltham, MA, USA) and up to 3 mg of total RNA were used ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 μl Superscript II First-Strand Buffer (5x, Invitrogen), 0.1 μl MgCl2 (100 mM ...
-
bioRxiv - Neuroscience 2022Quote: ... mRNA was reversed transcribed using Superscript II (ThermoFisher Scientific) and converted into second stranded DNA by DNA polymerase I (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... and reverse transcribed with Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and dispase II (5 mg/mL, Thermo Fisher Scientific) at 37°C for 60 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Dissociated cells were assessed for viability (Countess II; Invitrogen) and cell-density diluted to 700 cell/µl ...
-
bioRxiv - Neuroscience 2021Quote: ... cell suspensions were assessed for viability (Countess II; Invitrogen) and cell-density diluted to 700 cell/µl ...
-
bioRxiv - Molecular Biology 2020Quote: ... SuperScript® II Reverse Transcriptase (Invitrogen™, Life Technologies) was used for the reverse transcription step ...
-
bioRxiv - Molecular Biology 2020Quote: ... SuperScript® II Reverse Transcriptase (Invitrogen™, Life Technologies) was used for the reverse transcription step ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was reverse transcribed using random decamers and M-MLV reverse transcriptase (Promega)/Superscript II RNase H reverse transcriptase (Thermo Fisher Scientific). Quantitative RT-PCR was performed on a BioRad CFX Connect system using iTaq Universal SYBR Green Supermix (BioRad) ...
-
bioRxiv - Cell Biology 2022Quote: ... and ultrapure hydrogen peroxide (ULTREX II, 30%, Fisher Scientific). 30 lysate ...
-
bioRxiv - Genomics 2020Quote: ... and SuperScript™ II Reverse Transcriptase (Thermo Fisher, 18064014) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 25 mM sodium bicarbonate and 0.25% AlbuMAX II (GIBCO) or 5% heat-inactivated human sera in O+ RBCs from malaria-naive donors (Australian Red Cross blood bank) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and reverse transcription was done with Superscript II (Invitrogen) as previously described 68 using primer AM Dscam 13R2 (GCCGAGAGTCCTGCGCCGATTCCATTCACAG ...
-
bioRxiv - Developmental Biology 2019Quote: ... anti-Collagen Type II (Thermo Scientific, MS235B, 1:100), anti-Collagen Type X (Quartett ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesized with SuperScript II Reverse Transcriptase (Invitrogen) from 1 µg of RNA sample ...
-
bioRxiv - Cell Biology 2019Quote: Cells were cytospun using Shandon Cytospin II (Thermo Scientific), dried and fixed in methanol ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA synthesis was performed using SuperScript II (Thermo Fisher) and qPCR using 2x Takyon for SYBR Assay – no ROX (Eurogentec ...
-
bioRxiv - Immunology 2019Quote: ... Using Phusion Hot Start II DNA Polymerase (Thermo Fisher) and DNA template (up to 1 μg ...
-
bioRxiv - Biochemistry 2020Quote: ... and (ii) 6 μl of Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2019Quote: ... and cloned into pCR II-TOPO TA vector (Invitrogen). An AvrII site was introduced abutting the runt stop codon ...
-
bioRxiv - Genetics 2021Quote: ... Reverse transcription was done using SuperScript II RT (Invitrogen) and qRT-PCR was performed using SYBR FAST Universal 2X qPCR Master Mix (Kapa ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was generated using Superscript II Reverse Transcriptase (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... containing 1 mg/ml collagenase II (Thermo Fisher Scientific) for 2 h at 37 °C in a shaking water bath ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized using SuperScript II Reverse Transcription (Invitrogen). Real time quantitative PCR was performed with KAPA SYBR FAST Universal reagent (Roche ...
-
bioRxiv - Genetics 2020Quote: ... 0.5 µL Phusion HS II DNA Polymerase (ThermoFisher #F549L), and water to 50 µL ...