Labshake search
Citations for Thermo Fisher :
2151 - 2200 of 3282 citations for HSD17B4 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Kif4A was targeted using 16 nM custom silencer s elect siRNA (sense strand GCAAGAUCCUGAAAGAGAUtt, Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... hKid (Kif22) was targeted using 16 nM custom silencer select siRNA (sense strand CAAGCUCACUCGCCUAUUGtt, Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 25 pmol of siRNA and 7.5 µl of Lipofectamine® RNAiMAX (Thermo Fisher Scientific, Rochester, NY) in 500 µl of Opti-MEM I Reduced Serum Medium (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were transfected into the cancer cells with Lipofectamine™ RNAiMAX Transfection Reagent (ThermoFisher Scientific, 13778150).
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected at a final concentration of 50nM siRNA using Lipofectamine RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s instructions using following siRNAs ...
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Cancer Biology 2022Quote: RNA interference was conducted using siRNA specific to CD47 and APP (#s1501, #145977; Thermo Fisher Scientific) with a negative siRNA (Silencer Select #1 ...
-
bioRxiv - Cell Biology 2022Quote: ... or siRNAs against mouse Adgrg6 (MSS278013: #13 CGACUGCCAAGGGCCUGUCAUUUAA MSS210995: #95 GCCUCCAAAUUUGCUUGAGAAUUUA; MSS210997: #97 CCGUGUUACCCUAAUGACUACCCUA, ThermoFisher Scientific). Transfection was performed using Lipofectamine 2000 (LS11668019 ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were transfected with each Inhba siRNA using Lipofectamine 2000 Transfection Reagent (Invitrogen, Grand Island, NY) for 6 h ...
-
bioRxiv - Cell Biology 2022Quote: ... a 6 well plate was treated with 30 pmol of siRNA using RNAiMax transfection reagent (Invitrogen) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: The expression of RAPH1 was suppressed using 83 nM siRNA and lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Plasmids and siRNAs were co-delivered by reverse transfection using Lipofectamine 2000 (Thermo Fisher Scientific 11668) for Cos-7 cells and Lipofectamine 3000 for HepG2 cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... CIITA or non-targeting siRNA (Horizon Discovery) were transfected into HMC3 cells using Lipofectamine RNAiMAX (Invitrogen) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: siRNAs targeting Pkn1 (s115927), PP2Aca (#1: s72067, #2: s72066) and PP2Acb (s72069) were obtained from Invitrogen. For siRNA gene knock-down experiments ...
-
bioRxiv - Cell Biology 2024Quote: ... and IGF-1 receptor (Catalog number: AM51331, siRNA ID:110754) with Lipofectamine RNAiMax Transfection Reagent (Invitrogen), according to manufacturer’s established protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were seeded and transfected with 2.5 nM siRNA the next day using Lipofectamine2000 (Thermo Fisher) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA (72 nM) was transfected using Lipofectamine 3000 reagent as per the manufacturer’s protocol (Invitrogen #L3000001). The pcDNA5 FRT/TO MycLAP-STIL plasmids was ordered from Addgene (#80266) ...
-
bioRxiv - Physiology 2024Quote: ... or an equivalent concentration of a scrambled control siRNA (#4390844, Silencer Select Negative Control #1, Ambion) using Lipofectamine RNAimax (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Transient siRNA knockdown was achieved by forward transfection of LD652 with Cellfectin II (Gibco; Table S4) according to the manufacturer’s protocol for 48 h prior to infection ...
-
bioRxiv - Neuroscience 2024Quote: ... 25nM siRNAs were transfected into HEK 293T cells using 0.6μL RNAimax reagent (Thermo Fisher Scientific, 13778075) with 50 μl Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... 72 h after siRNA transfection the medium was changed to FluoroBrite DMEM Media (Thermo Fisher Scientific) with 10% serum ...
-
bioRxiv - Cell Biology 2024Quote: ... Huh7-ACE2 cells were transfected with siRNA oligos (final concentration, 50 nM) by RNAi-MAX (Invitrogen) on day 1 and infected with SARS-CoV-2 on day 3 ...
-
bioRxiv - Cell Biology 2024Quote: ... The constructs and their final concentrations used were as follows: 100 nM KIF18A siRNA (4390825; Ambion), 100 nM KIF4A siRNA (sc-60888 ...
-
bioRxiv - Immunology 2023Quote: ... siRNA-treated target NK or T cells were labelled with 2 uM CellTrace Violet (Thermo Fisher), treated with 1 uM Concanamycin A (Santa Cruz ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 nM of each siRNA was transfected into 105 HeLa cells using Lipofectamine RNAiMAX (#13778075, Invitrogen, Carlsbad ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA transfection was performed using reverse transfection protocols with Lipofectamine RNAiMAX transfection reagent (13778, Life technologies). For CLTC knockdown ...
-
bioRxiv - Cell Biology 2024Quote: These siRNA oligonucleotides were designed using Invitrogen Block-iT RNAi Designer and purchased from Thermo Fisher or Dharmacon.
-
bioRxiv - Microbiology 2024Quote: ... 2×104 HeLa cells were reverse transfected with 10 nM siRNA using Lipofectamine RNAiMax (Life Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Transient transfection of cells with siRNA was performed in 24-well plates using Lipofectamine RNAiMAX (Invitrogen), and cells were transfected with DNA plasmids was performed using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with siTools TCF7L2 siRNA pool using the Lipofectamine RNAiMAX reagent (Thermo Fisher Scientific) to the proportions of 2 μL of 20nM siRNA per well ...
-
bioRxiv - Cancer Biology 2024Quote: ... siRNA oligos were transfected into cells using Lipofectamine RNAiMax Reagent according to the manufacturer’s protocol (Invitrogen). A reverse transfection was performed on day 1 ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transiently transfected with 100 nM of siRNAs using Lipofectamine 3000 (L3000015, Invitrogen, Beijing, China). Gene silencing efficiency was confirmed by qPCR 48 h post-transfection ...
-
bioRxiv - Microbiology 2022Quote: ... SK-N-SH cells were reverse-transfected with 20 nM of siRNA using Lipofectamine RNAiMAX (Invitrogen) in collagen-coated 96-well plates and then cultured for 60 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... a single siRNA targeting the human TP53 gene was synthesized and purchased from Ambion (Life Technologies). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... VIM (ID: s14800) or Silencer Negative Control siRNA was diluted in lipofectamine P3000 (Thermo Fisher Scientific) and added to the cells at a final concentration of 5 pmol/μL in serum-free Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 15 nM siRNA Control using 7 ul of Lipofectamine™ RNAiMAX transfection reagent (ThermoFisher Scientific) for each well according to the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Small interfering RNA (siRNA) transfection was performed with Lipofectamine RNAiMax Transfection Reagent (Thermo Fisher Scientific, 13778030) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Negative control (Assay ID: 4390843) and Egr1 siRNAs (Assay ID: 157282) were purchased from Thermo Fisher Scientific ...
-
The CB1 receptor interacts with cereblon and drives cereblon deficiency-associated memory shortfallsbioRxiv - Neuroscience 2023Quote: Silencing of CRBN was achieved by transfecting HEK-293T cells with the following stealth siRNAs (Invitrogen) (Ito et al ...
-
bioRxiv - Cell Biology 2023Quote: ... Cultured cells were transfected with siRNAs or plasmids using Lipofectamine 2000 (Invitrogen, CA, USA, #11668-019) following the manufacturer’s protocol ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: Z310 cells were transiently transfected with small interfering RNA (siRNA) using Lipofectamine RNAiMax (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: HFF and hESC and MEF were transfected with small interfering RNAs (siRNAs) using Lipofectamine RNAiMAX (Invitrogen). TriFECTa kit DsiRNA Duplex (IDT ...
-
bioRxiv - Immunology 2023Quote: siRNA pool was mixed with Interferin (Polyplus-transfection, #409-10) in Opti-MEM (Life Technologies, #31985062), incubated for 10min at room temperature and added to pre-plated 200,000 BMDCs ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: PC3-AR cells were transfected with 20 nM of Negative Control siRNA #1 (siCon, Ambion AM4635), siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’ ...
-
bioRxiv - Developmental Biology 2022Quote: ... or Peg3 On-Target Plus SMART pool siRNA (Dharmacon, Lafayette, CO; Thermo Fisher Scientific, Lafayette, CO) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... differentiated healthy and DMD myotubes were transfected with either dystrophin and scramble siRNAs (Thermo Fisher Scientific) at 1 nM final concentration using Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA transfection of human primary macrophages was performed using the Neon Transfection System (Invitrogen, Darmstadt, Germany) with standard settings (1000 V ...
-
bioRxiv - Cell Biology 2023Quote: ... The negative control siRNA was Silencer™ Select negative control N° 2 (cat# 4390846, Thermo Fisher).
-
bioRxiv - Molecular Biology 2023Quote: ... differentiated astrocytes were transfected with the respective siRNA oligonucleotides by Lipofectamine RNAiMax reagent (Thermo Fisher Scientific). Silencer select siRNAs targeting moue Ep400 (si-Ep400#1 ...
-
bioRxiv - Cell Biology 2023Quote: ... plasmids and siRNA were transfected in mammalian cells at 70% confluency using Lipofectamine 3000 (Invitrogen, #L3000001). PLK4 siRNA and CEP152 siRNA oligonucleotides (Merck ...