Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 3080 citations for HSD17B4 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... shTMEFF2-6 and shTMEFF2-9 sequences were generated using the siRNA Wizard online tool by Invitrogen: https://www.invivogen.com/sirnawizard/) ...
-
bioRxiv - Microbiology 2020Quote: ... Various siRNA concentrations were complexed with the transfection reagent Lipofectamine RNAiMax transfection reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... or control non-target siRNA (#D-001810-01-05, Dharmacon) using Lipofectamine RNAiMAX (#13778150, Fisher Scientific) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with siRNA (5’-GGACTGAGGUUGUCAAGAA-3’) for PRC1 using Oligofectamine (Life Technologies, Carlsbad, CA) as previously described (Udy et al. ...
-
bioRxiv - Cancer Biology 2019Quote: Silencing of TAZ and YAP1 was performed by using 10nM Silencer Select siRNAs (Thermo Fisher Scientific), whose sequences are detailed in Suppl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... grown to ∼80% confluence and transfected with siRNA duplexes using Lipofectamine 3000 (Invitrogen, Camarillo, CA, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: ... HeLa Kyoto cells were transfected with 50nM of siRNA reagents using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2021Quote: 5x104 Hela cells per well were reverse transfected with 15pmol siRNA using Lipofectamine RNAiMax (ThermoFisher Scientific) in an 8 well chamber slide according to recommended protocols ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNA transfections used Lipofectamine RNAiMax according to the manufacturer’s protocol (Thermo Fisher Scientific, Waltham, Massachusetts USA). For quantitative RT-PCR measurements ...
-
bioRxiv - Genomics 2021Quote: P19 EC cells were transfected with double-strand siRNA using Lipofectamine™ RNAiMAX (Thermo Fisher Scientific) with the final concentration at 50 nM for 3 d and then collected for western blot assay ...
-
bioRxiv - Cell Biology 2020Quote: ... RNAi reagents included: Silencer Select Negative Control Number 1 siRNA (Ambion, Thermo Fisher, catalog number 4390843), Silencer Select RAB8A (Ambion ...
-
bioRxiv - Cell Biology 2020Quote: ... RNAi reagents included: Silencer Select Negative Control Number 1 siRNA (Ambion, Thermo Fisher, catalog number 4390843), Silencer Select RAB8A (Ambion ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections with Ambion Silencer Select siRNAs were performed for 72h using Lipofectamine RNAiMAX (Thermo Fisher Scientific). The following Silencer Select siRNAs were used at a final siRNA concentration of 25nM ...
-
bioRxiv - Microbiology 2021Quote: ... siRNAs were delivered to 96 wells at 50% confluency using Lipofectamine RNAiMax (ThermoFisher Scientific, Waltham, MA) to a final concentration of 100nM per well ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipofectamine 2000 was utilised and reverse transfection was used in all siRNA assays (Thermo Fisher Scientific). Target gene and protein expression were assessed at 24-48 hours post transfection ...
-
bioRxiv - Developmental Biology 2021Quote: siRNAs targeting human CDK12 (Dharmacon D-004031-01 and D-004031-02) CDK13 (Life Technologies s16398) or control siRNAs (final concentration 10 nM ...
-
bioRxiv - Developmental Biology 2021Quote: RPE hTERT cells were passaged on glass coverslips and transfected with siRNA using Lipofectamine RNAiMax (Invitrogen). OTP non-targeting pool (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... For knockdown experiments silencer select siRNAs against SRSF1 and TP53 (Thermo Fisher Scientific #4392420 and #4390824) along with a negative control (Thermo Fisher Scientific #4390843 ...
-
bioRxiv - Cell Biology 2021Quote: ... Kif4A was targeted using 16 nM custom silencer s elect siRNA (sense strand GCAAGAUCCUGAAAGAGAUtt, Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... hKid (Kif22) was targeted using 16 nM custom silencer select siRNA (sense strand CAAGCUCACUCGCCUAUUGtt, Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 25 pmol of siRNA and 7.5 µl of Lipofectamine® RNAiMAX (Thermo Fisher Scientific, Rochester, NY) in 500 µl of Opti-MEM I Reduced Serum Medium (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were transfected into the cancer cells with Lipofectamine™ RNAiMAX Transfection Reagent (ThermoFisher Scientific, 13778150).
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected at a final concentration of 50nM siRNA using Lipofectamine RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s instructions using following siRNAs ...
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Cancer Biology 2022Quote: RNA interference was conducted using siRNA specific to CD47 and APP (#s1501, #145977; Thermo Fisher Scientific) with a negative siRNA (Silencer Select #1 ...
-
bioRxiv - Cell Biology 2022Quote: ... or siRNAs against mouse Adgrg6 (MSS278013: #13 CGACUGCCAAGGGCCUGUCAUUUAA MSS210995: #95 GCCUCCAAAUUUGCUUGAGAAUUUA; MSS210997: #97 CCGUGUUACCCUAAUGACUACCCUA, ThermoFisher Scientific). Transfection was performed using Lipofectamine 2000 (LS11668019 ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were transfected with each Inhba siRNA using Lipofectamine 2000 Transfection Reagent (Invitrogen, Grand Island, NY) for 6 h ...
-
bioRxiv - Cell Biology 2022Quote: ... a 6 well plate was treated with 30 pmol of siRNA using RNAiMax transfection reagent (Invitrogen) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: The expression of RAPH1 was suppressed using 83 nM siRNA and lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Plasmids and siRNAs were co-delivered by reverse transfection using Lipofectamine 2000 (Thermo Fisher Scientific 11668) for Cos-7 cells and Lipofectamine 3000 for HepG2 cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... CIITA or non-targeting siRNA (Horizon Discovery) were transfected into HMC3 cells using Lipofectamine RNAiMAX (Invitrogen) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: siRNAs targeting Pkn1 (s115927), PP2Aca (#1: s72067, #2: s72066) and PP2Acb (s72069) were obtained from Invitrogen. For siRNA gene knock-down experiments ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transiently transfected with 100 nM of siRNAs using Lipofectamine 3000 (L3000015, Invitrogen, Beijing, China). Gene silencing efficiency was confirmed by qPCR 48 h post-transfection ...
-
bioRxiv - Microbiology 2022Quote: ... SK-N-SH cells were reverse-transfected with 20 nM of siRNA using Lipofectamine RNAiMAX (Invitrogen) in collagen-coated 96-well plates and then cultured for 60 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... a single siRNA targeting the human TP53 gene was synthesized and purchased from Ambion (Life Technologies). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... VIM (ID: s14800) or Silencer Negative Control siRNA was diluted in lipofectamine P3000 (Thermo Fisher Scientific) and added to the cells at a final concentration of 5 pmol/μL in serum-free Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 15 nM siRNA Control using 7 ul of Lipofectamine™ RNAiMAX transfection reagent (ThermoFisher Scientific) for each well according to the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Small interfering RNA (siRNA) transfection was performed with Lipofectamine RNAiMax Transfection Reagent (Thermo Fisher Scientific, 13778030) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Negative control (Assay ID: 4390843) and Egr1 siRNAs (Assay ID: 157282) were purchased from Thermo Fisher Scientific ...
-
The CB1 receptor interacts with cereblon and drives cereblon deficiency-associated memory shortfallsbioRxiv - Neuroscience 2023Quote: Silencing of CRBN was achieved by transfecting HEK-293T cells with the following stealth siRNAs (Invitrogen) (Ito et al ...
-
bioRxiv - Cell Biology 2023Quote: ... Cultured cells were transfected with siRNAs or plasmids using Lipofectamine 2000 (Invitrogen, CA, USA, #11668-019) following the manufacturer’s protocol ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: Z310 cells were transiently transfected with small interfering RNA (siRNA) using Lipofectamine RNAiMax (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: HFF and hESC and MEF were transfected with small interfering RNAs (siRNAs) using Lipofectamine RNAiMAX (Invitrogen). TriFECTa kit DsiRNA Duplex (IDT ...
-
bioRxiv - Immunology 2023Quote: siRNA pool was mixed with Interferin (Polyplus-transfection, #409-10) in Opti-MEM (Life Technologies, #31985062), incubated for 10min at room temperature and added to pre-plated 200,000 BMDCs ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: PC3-AR cells were transfected with 20 nM of Negative Control siRNA #1 (siCon, Ambion AM4635), siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’ ...
-
bioRxiv - Developmental Biology 2022Quote: ... or Peg3 On-Target Plus SMART pool siRNA (Dharmacon, Lafayette, CO; Thermo Fisher Scientific, Lafayette, CO) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... differentiated healthy and DMD myotubes were transfected with either dystrophin and scramble siRNAs (Thermo Fisher Scientific) at 1 nM final concentration using Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA transfection of human primary macrophages was performed using the Neon Transfection System (Invitrogen, Darmstadt, Germany) with standard settings (1000 V ...
-
bioRxiv - Cell Biology 2023Quote: ... The negative control siRNA was Silencer™ Select negative control N° 2 (cat# 4390846, Thermo Fisher).
-
bioRxiv - Molecular Biology 2023Quote: ... differentiated astrocytes were transfected with the respective siRNA oligonucleotides by Lipofectamine RNAiMax reagent (Thermo Fisher Scientific). Silencer select siRNAs targeting moue Ep400 (si-Ep400#1 ...