Labshake search
Citations for Thermo Fisher :
2151 - 2200 of 10000+ citations for 7 Chloro 3 nitro 3 4 dihydro 1H quinolin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Bioengineering 2019Quote: ... via covalent attachment to COOH groups on the particles via standard EDC chemistry using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Thermo Fisher Scientific, MA) and N-hydroxysulfosuccinimide sodium salt (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Microbiology 2020Quote: Vero E6 and Calu-3 cells (Calu-3:ATCC HTB-55; Vero E6: ATCC, CRL-1586) were maintained in high glucose DMEM (Gibco, Waltham, MA, USA) supplemented with 10% FBS (R&D Systems ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... A recombinant lentivirus vector expressing the coding sequence of the EBV transactivator BZLF1 under control of a tetracycline-regulated promoter was constructed by cloning the open reading frame amplified with the primers 5’-CGACCGGTATGATGGACCCAAACTCGAC-3’ and 5’-CGACGCGTTTAGAAATTTAA GAGATCCTCGTGT-3’ into the Age I and Mlu I sites of the pTRIPZ lentiviral vector (Thermo Fisher Scientific, USA). For virus production ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135; 10 kD BDA Invitrogen D1956; diluted in 0.9% NaCl) were used as retrograde and anterograde tracers ...
-
bioRxiv - Molecular Biology 2022Quote: ... pDNOR207-ZNF451-1 (isoform 1) and pDNOR207-ZNF451-3 (isoform 3) were generated using the Gateway® cloning BP reaction (Thermo Fisher Scientific) upon cDNA amplification using BP-tailed primers and pDNOR207 as donor vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 ng/mL (n = 3) and 10 ng/mL (n = 3) treatment were subjected to albumin depletion according to the manufacturer’s instructions (Thermo Fisher Scientific, Loughborough, UK). Individual samples were digested with trypsin (2.5µg trypsin ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were washed in 3 times in 3% PBST (10 min) and incubated in goat anti-chicken Alexa Fluor 488 (Invitrogen, A11039, 1:1000) in blocking buffer at room temperature for 2hrs ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... each sample was injected onto an EASY-Spray PepMap C18 column (75 mm id 3 25 cm, 2 mm particle size) (Thermo Scientific) and separated over a 2-h method ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were injected and concentrated on a trap column (PepMap100 C18, 3 µm, 100 Å, 75 µm i.d. x 2 cm, Thermo Scientific) equilibrated with 0.05% TFA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides were injected onto an Acclaim PepMap100 C18 trap column (75 μm i.d., 2 cm long, 3 μm, 100 Å, Thermo Scientific) and further separated on an Acclaim PepMap100 C18 analytical column (75 μm i.d. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptide mixtures were loaded on a C18 Acclaim PepMap100 trap-column (75 μm ID x 2 cm, 3 μm, 100Å, ThermoFisher Scientific) for 3.5 minutes at 5 μL/min with 2% ACN (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 2-3 ml of logarithmically growing yeast cells in DOA media were added to a 35 mm FluoroDish (Fisher Scientific; 15199112) which had been pre-incubated at 30°C with Concanavalin A (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: Bone marrow was obtained from 2-3-month-old mice and cultured with 100 ng/ml of M-CSF (Prospec Bio) in αMEM (Gibco Invitrogen) supplemented with 10% FCS for three days ...
-
bioRxiv - Biophysics 2019Quote: ... pieces of tissue containing 2-3 tracheal segments were dissected in ice-cold Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (ThermoFisher, DMEM/F12). Tissue sections were sliced open along the proximal-distal axis from the dorsal side and mounted onto 35mm cell imaging dishes (Mat-Tek) ...
-
bioRxiv - Biophysics 2021Quote: ... between 0.5-2 mg of individual histones were combined and dialyzed into 2 M NaCl (10 K MWCO, 3-12 mL Slide-A-Lyzer Dialysis Cassettes, ThermoFisher Scientific). After dialysis the histones in 2 M NaCl were concentrated to a volume of 1 mL and purified using an Superdex 200 column (GE Healthcare ...
-
bioRxiv - Systems Biology 2021Quote: ... Peptide mixtures were injected in 0.1% TFA on a C18 Acclaim PepMap100 trap-column (75 μm ID × 2 cm, 3 μm, 100Å, Thermo Fisher Scientific) for 3 min at 5 μL/min with 2% ACN ...
-
bioRxiv - Biochemistry 2020Quote: ... targeting the TLR3 gene (5’-CCUGAUGAUCUUCCCUCUAACAUAA-3’) and Stealth RNAi siRNA negative control med GC Duplex #2 were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... we added a 1 mL of the following mixture to the culture media and incubated the cells at 25°C incubator for 1—3 hours: 5 μM Fura-2 AM (F-1201, Life Technologies), 250 μM probenecid (162-26112 ...
-
bioRxiv - Neuroscience 2020Quote: Cortical primary neurons from newborn triple neurexin-1/2/3 conditional KO mice13 were seeded on Matrigel-coated coverslips in a 24-well plate in MEM medium (ThermoFisher Scientific). On DIV2 ...
-
bioRxiv - Biophysics 2021Quote: α2-GFP or α2:β at 1:3 ratio was transfected into HEK293T cells on collagen coated glass bottom dishes using lipofectamine 3000 (Invitrogen) for expression of α2 GlyR or α2β GlyR ...
-
bioRxiv - Neuroscience 2021Quote: 2.5 μg peptides were pre-concentrated with a flow of 3 μL/min for 10 min using a C18 trap column (Acclaim PepMap100, 100 μm x 2 cm, Thermo Scientific) and then loaded onto a 50 cm long C18 column (75 μm ID ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μg peptides from each fraction was loaded onto trap column nanoViper 2 cm (3 μm C18 Aq) (Thermo Fisher Scientific). Peptide separation was carried out using EASY-Spray C18 analytical column (15 cm ...
-
bioRxiv - Plant Biology 2021Quote: ... The leaf discs were then counterstained by immersing them in 0.02 µg/mL DAPI in water for 3 min and rinsed 2× in water before imaging them using a fluorescence microscope (Evos, Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... The peptides were loaded onto an Acclaim PepMap 100 (ID 75μm x 2 cm, 3 μm, 100 Å) pre-column and separated on an EASY-Spray column (Thermo Scientific; ID 75 μm × 25 cm ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μL (60 pmol) of this mixture was added to 2 μL of TrueCut™ Cas9 v2 (∼60 pmol, ThermoFisher A36498), incubated at room temperature for 15 minutes to promote formation of Cas9:gRNA complexes ...
-
bioRxiv - Microbiology 2020Quote: ... The experimental setup was as follows: the peptide mixture was loaded onto a 75 μm × 2 cm precolumn (Acclaim PepMap 100, C18, 3 μm, Thermo Scientific) and eluted over 60 min using a 75 μm × 25 cm analytical column (Acclaim PepMap RSLC ...
-
bioRxiv - Cell Biology 2020Quote: ... The peptides were applied to a C18 column (Acclaim PepMap 100 pre-column, C18, 3 μm, 2 cm × 75 μm Nanoviper, Thermo Scientific) and subsequently separated using an analytical column (EASY-Spray column ...
-
bioRxiv - Immunology 2022Quote: ... Peptides were loaded onto an Acclaim PepMap 100 (75μm x 2 cm) C18 (3 μm, 100 Å) pre-column and separated on an EASY-Spray column (Thermo Scientific; ID 75μm x 50 cm ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 cm length) and EASY-Column (75 μm inner diameter, 10 cm length, 3 μm particle size, both Thermo Fisher Scientific). The separated peptides were analyzed using LTQ-Orbitrap Velos mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... and then 1 μg of each peptide sample was loaded on a rap column (75 µm × 2 cm, 3 µm, C18, Thermo Fisher). The eluate was loaded onto a reversed-phase analytical column (50 µm × 250 mm ...
-
bioRxiv - Molecular Biology 2022Quote: ... The nTAP-MS peptides were applied on an Acclaim PepMap 100 C18 trap column (75 μm ID x 2 cm, 3 μm, Thermo Scientific) in 0.1% formic acid ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10μM EdU was added for 2h to either day 2 or day 3 cultures and developed using the Click-IT EdU Alexa Fluor imaging kit (Life Technologies).
-
bioRxiv - Cell Biology 2022Quote: ... and loaded on a 20 mm pre-column (C18 Acclaim PepMapTM 100, 75 µm x 2 cm, 3 µm, 100Å, Thermo Scientific) and separated on a 50 mm analytical column (C18 Acclaim PepMapTM RSLC ...
-
bioRxiv - Microbiology 2021Quote: ... recombinant SARS-CoV-2 Spike RBD protein (RBD, His Tag) was conjugated with EZ-LinkTM Sulfo-NHS-Biotin (1:3 molar ratio; Thermo Fisher) in Dulbecco’s PBS at room temperature for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... Parasitemia was monitored daily by flow cytometry by diluting 10 μl of each parasite culture well from 2-3 biological replicates into 200μl of 1.0 μg/ml acridine orange (Invitrogen Life Technologies A3568) in phosphate buffered saline (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant SARS-CoV-2 spike protein was conjugated with EZ-Link™ Sulfo-NHS-Biotin (1:3 molar ratio; Thermo Fisher) in Dulbecco’s PBS at room temperature for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... tryptic peptides obtained from StageTip-based SCX fractionation were reconstituted in 0.1% formic acid and loaded on a nanoViper 2 cm (3 µm C18 Aq) trap column (Thermo Fisher Scientific). Peptide separation was carried out using EASY-Spray C18 analytical column (50 cm ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acids were extracted on ice-cold lysis buffer [5:3:2 ratio of methanol-acetonitrile-water (Fisher Scientific, Pittsburgh, PA)] containing 3 µM of amino acid standards [Cambridge Isotope Laboratories ...
-
bioRxiv - Systems Biology 2022Quote: ... Peptide mixtures were injected in 0.1% TFA on a C18 Acclaim PepMap100 trap-column (75 μm ID x 2 cm, 3 μm, 100Å, Thermo Fisher Scientific) for 3 min at 5 μL/min with 2% ACN ...
-
bioRxiv - Genetics 2022Quote: ... Samples were injected and concentrated on a trap column (PepMap100 C18, 3 μm, 100 Å, 75 μm i.d. x 2 cm, Thermo Scientific) equilibrated with 0.05% trifluoroacetic acid in water ...
-
bioRxiv - Immunology 2019Quote: ... biological triplicates or quadruplicates of mixes of 1 µg of light-labelled and 1 µg of heavy-labelled samples were analysed on an Orbitrap Velos Pro mass spectrometer coupled to an Ultimate 3000 UHPLC system with a 50 cm Acclaim PepMap 100 or EasySpray analytical column (75 μm ID, 3 μm C18) in conjunction with a Pepmap trapping column (100 μm × 2 cm, 5 μm C18) (Thermo-Fisher Scientific). Acquisition settings were ...
-
bioRxiv - Molecular Biology 2019Quote: ... Beads were gently washed 3 times with 1 ml of KPBS using a DynaMag-2 magnet (Thermo Fisher Scientific cat# 12321D). Beads were resuspended in 1 ml of KPBS and transfer to a new tube ...