Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 10000+ citations for 6 CHLORO 4 METHYL 3 PHENYLCOUMARIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... fluo-4 (Invitrogen). Ca2+ and Lifeact images were acquired at 1 image/10 seconds.
-
bioRxiv - Bioengineering 2022Quote: ... 4% Glutamax (ThermoFisher), 1% Sodium Pyruvate (ThermoFisher ...
-
bioRxiv - Bioengineering 2022Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... 4 % FCS (Gibco), 200 units/mL penicillin and 0.2 mg/ mL streptomycin ...
-
bioRxiv - Genomics 2021Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4% B27-(ThermoFisher), 100 µM Palmitate (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... claudin-4 (Invitrogen), occludin (Cell Signaling Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... claudin-4 (Invitrogen), occludin (Cell Signaling Technologies) ...
-
bioRxiv - Plant Biology 2020Quote: ... the samples were centrifuged before receiving 50 µL of N-Methyl-M (trimethylsilyl) trifluoroacetamide (MSTFA) + 1% trimethylchlorosilane (TMCS) (ThermoFisher Scientific, Waltham, MA, USA), briefly vortexed and incubated at 60 °C for 40 min ...
-
bioRxiv - Systems Biology 2021Quote: ... the samples were centrifuged before receiving 50 μL of N-Methyl-M (trimethylsilyl) trifluoroacetamide (MSTFA) + 1 % trimethylchlorosilane (TMCS) (ThermoFisher Scientific, Waltham, MA, USA), briefly vortexed and incubated at 60 °C for 40 min ...
-
bioRxiv - Genomics 2020Quote: ... Primers specific for the methylated bisulphite converted DNA (GAGGAGGAGGGGGTTTGTTAT and AAATCAATAACCTAATAACCACACAC) were designed using Methyl Primer Express (Applied Biosystems, Foster City, CA, USA). After PCR amplification ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Dried samples were dissolved in 250 µl of silylation-grade acetonitrile followed by addition of 250 µl of N-methyl-N- (trimethylsilyl)trifluoroacetamide (MSTFA) with 1% trimethylchlorosilane (TMCS) (Thermo Scientific, Bellefonte, PA) and heated for 1 hr at 70 °C to generate trimethylsilyl derivatives ...
-
bioRxiv - Molecular Biology 2021Quote: ... cryosectioned zebrafish larvae were washed 3x in wash buffer for 5 min and subsequently stained with Filipin solution for 60 min in a humidified dark chamber and co-stained with BODIPY TR methyl ester (1:300, Life Technologies, Darmstadt, Germany). Staining solution was removed and slides were washed twice in wash buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were stained with CellTrace BODIPY TR methyl ester (1:200 in PDT [1 % DMSO, 0.1 % Triton X-100 in PBS], cat# C34556, Thermo Fisher Scientific, Waltham, MA) for 20 min at RT and/or DAPI (5 mg/ml ...
-
bioRxiv - Plant Biology 2022Quote: ... The sample was dried under a stream of air and resuspended in 50μL of N-methyl-N-(trimethylsilyl) trifuoroacetamide (MSTFA) (Fisher scientific, Waltham, MA, USA), votexed to mix for 20 sec ...
-
bioRxiv - Molecular Biology 2023Quote: The mitochondrial membrane potential was measured using the tetramethylrhodamine methyl ester (TMRM, 50 nM, Life technology, T668) and Mitotracker Green (100nM, Thermo Fisher Scientific, M7514) fluorescent probes according to the manufacturers’ protocols ...
-
bioRxiv - Genomics 2023Quote: ... The right femurs of Inbred Founders were dehydrated in ethanol and embedded in poly methyl methacrylate (PMMA) (Thermo Scientific AAA130300F, Thermo Fisher Scientific). Plastic blocks were cut at the midpoint perpendicular to the bone long-axis and trimmed to 5 mm in length ...
-
bioRxiv - Genomics 2023Quote: ... The right femurs of Inbred Founders were dehydrated in ethanol and embedded in poly methyl methacrylate (PMMA) (Thermo Scientific AAA130300F, Thermo Fisher Scientific). Plastic blocks were cut at the midpoint perpendicular to the bone long-axis and trimmed to 5 mm in length ...
-
bioRxiv - Systems Biology 2023Quote: ... Val-Tyr-Val, methoxyamine hydrochloride (MeOX), N-methyl-N-(trimethylsilyl)-trifluoroactamide (MSTFA), and pyridine (Anhydrous, 99.8%) were all purchased from Fisher Scientific (Hampton, NH, USA). Fatty acid methyl esters (FAMEs ...
-
bioRxiv - Plant Biology 2023Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... The cells were maintained in fibroblast media for 6 days then passaged onto Matrigel-coated dishes for further reprogramming in Essential 6 medium plus human bFGF (ThermoFisher Scientific). The iPSC colonies were manually picked onto Matrigel-coated plates to generate stable iPSC lines ...
-
bioRxiv - Systems Biology 2021Quote: ... The cells were maintained in fibroblast media for 6 days then passaged onto Matrigel-coated dishes for further reprogramming in Essential 6 medium plus human bFGF (ThermoFisher Scientific). The iPSC colonies were manually picked onto Matrigel-coated plates to generate stable iPSC lines ...
-
bioRxiv - Developmental Biology 2022Quote: ... embedded in paraffin using the Tissue-Tek VIP 6 (Sakura) tissue processor and of 6 µm sections obtained with a microtome (HM355S, Thermo Scientific). Z-shaped probes for Sema6d (565871) ...
-
bioRxiv - Systems Biology 2020Quote: 1×10^6 cells were seeded in wells of 6-well plates (FALCON # 353046) in MEM without phenol red (Gibco # 51200038) supplemented with 0.5% Fetal Calf Serum (VWR #89510-184) ...
-
bioRxiv - Systems Biology 2020Quote: 1×10^6 cells were seeded in wells of 6-well plates (FALCON # 353046) in MEM without phenol red (Gibco # 51200038) supplemented with 0.5% Fetal Calf Serum (VWR #89510-184) ...
-
bioRxiv - Systems Biology 2020Quote: 1×10^6 cells were seeded in wells of 6-well plates (FALCON # 353046) in MEM without phenol red (Gibco # 51200038) supplemented with 0.5% Fetal Calf Serum (VWR #89510-184) ...
-
bioRxiv - Genomics 2021Quote: ... 600,000 cells were plated in 6 well plates and transfected with 2 μg plasmid DNA using 6 μl Lipofectamine LTX reagent (Thermo Fisher). Medium was exchanged after 16 h and harvested 24 h later ...
-
bioRxiv - Microbiology 2023Quote: ... cells were plated at 650,000 cells per well of a 6 well plate and infected with 6 dilutions from a 10-fold dilution series in 1% FBS (Gibco, MA)/1X non-essential amino acids (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... The IL-6 levels in plasma were analyzed using a Mouse IL-6 Uncoated ELISA kit (#88-7064, Invitrogen, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Molecular Biology 2021Quote: ... counted and reseeded in 3 mL A medium (1:3 mix DMEM/F12 (Gibco) and Neurobasal (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2019Quote: 3’-tRNAs biotinylation was adapted from Pierce RNA 3’-End Biotinylation Kit (Thermo Fisher). Deacylated tRNAs were denaturated in 25% DMSO at 85°C for 5 minutes and directly chilled on ice ...
-
bioRxiv - Neuroscience 2019Quote: ... NIM was exchanged for “3:1 medium” containing 3 parts DMEM (Gibco, #10569‒010) per 1 part F12 medium (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl were sampled on a 3 well Diagnostika slides (X1XER303B) from Thermo scientific for observation on an Zeiss LSM710 confocal microscope equipped with a Plan-Apochromat 63×/1.4 Oil objective and 405 nm and 488 nm lasers ...
-
bioRxiv - Microbiology 2023Quote: ... 3′RNA-seq libraries were analyzed on a Qubit 3 Fluorometer (Thermo Fisher Scientific) and an Agilent 4200 TapeStation System prior to paired- end sequencing using the HiSeq 2500 system (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... 3 μg DNA and 3 μL Lipofectamine in 300 μl Optimem (Thermofisher Scientific, USA) were used per well containing 700 μl DMEM ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of 4 mM resazurin sodium salt (Acros Organics, Belgium), 0.002 U purified Castellaniella defragrans geraniol dehydrogenase ...
-
bioRxiv - Biophysics 2019Quote: Isolated islets were loaded with 4 µM Fluo-4 AM (Invitrogen) for 45min at 37°C in imaging medium (125mM NaCl ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... isolated with Protein A Dynabeads (Invitrogen; 4 h at 4°C), washed thrice with RSB+T ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Genomics 2021Quote: ... 3 mL (Thermo Fisher Scientific) overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific 15557044 ...