Labshake search
Citations for Thermo Fisher :
2101 - 2150 of 10000+ citations for 6 CHLORO 4 METHYL 3 PHENYLCOUMARIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and 6 U/ml DNase I (ThermoFisher Scientific)23,24 ...
-
bioRxiv - Immunology 2023Quote: ... and 6 U/ml DNase I (ThermoFisher Scientific) at 37°C and 750rpm for 30 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... in 6-multiwell plates (Nunclon, Thermo Fisher Scientific). Plants were cultivated for 24 h 16/8 h light/dark at 21–22°C without shaking ...
-
bioRxiv - Molecular Biology 2023Quote: ... on a QuantStudio 6 Flex instrument (Applied Biosystems) and a QuantStudio 5 Flex instrument (Applied Biosystems) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081) ...
-
bioRxiv - Neuroscience 2023Quote: ... in Essential 6 medium (Thermo Fisher Scientific, A1516401) supplemented with the SMAD pathway inhibitors dorsomorphin (2.5 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... -coated 6- well plates (Thermo Fisher Scientific, #140675) using Essential 8 Basal medium (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... on a QuantStudio 6 Flex instrument (Applied Biosystems) in fast cycling mode according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Following 6 hr incubation in OptiMEM (ThermoFisher Scientific) at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: α6-FITC (1:200, Invitrogen, 11-0495-82),
-
bioRxiv - Biophysics 2023Quote: ... using the QuantiStudio 6 Flex system (Applied Biosystems). Gene expression was analyzed using the ΔΔCT method ...
-
bioRxiv - Neuroscience 2023Quote: ... commercial labeling kits were used (A20181/6, ThermoFisher Scientific and Pierce ...
-
bioRxiv - Biophysics 2024Quote: ... on a QuantStudio™ 6 Flex (Applied Biosystems), where β-actin was examined as an internal control for normalization ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:5000), for 5 min in 1X PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) for 15 min in 1X PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 μL of NativePAGE sample buffer (Invitrogen BN2004) was added to samples and 10 μL of sample (∼15 μg of crude mitochondrial fraction ...
-
bioRxiv - Microbiology 2024Quote: ... on a QuantStudio 6 instrument (Thermo Fisher Scientific). ACTB and GAPDH were used as endogenous controls for relative quantification analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... and split every 6 days using dispase (Gibco) to remove non-neuronal cell types ...
-
bioRxiv - Neuroscience 2024Quote: ... in Essential 6 medium (Thermo Fisher Scientific, A1516401) supplemented with patterning molecules ...
-
bioRxiv - Systems Biology 2024Quote: ... qPCR was performed using QuantiStudio 6 (Life Technologies) with SYBR Power Green (Applied Biosystems ...
-
bioRxiv - Genomics 2019Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... 4% KSR (ThermoFisher), 1% ITS-X supplement (ThermoFisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... 4% KSR (ThermoFisher), 1% ITS-X supplement (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... SSEA-4 (ThermoFisher), Sox2 (Epitomics ...
-
bioRxiv - Physiology 2021Quote: ... fluo-4 (Invitrogen). Ca2+ and Lifeact images were acquired at 1 image/10 seconds.
-
bioRxiv - Bioengineering 2022Quote: ... 4% Glutamax (ThermoFisher), 1% Sodium Pyruvate (ThermoFisher ...
-
bioRxiv - Bioengineering 2022Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... 4 % FCS (Gibco), 200 units/mL penicillin and 0.2 mg/ mL streptomycin ...
-
bioRxiv - Genomics 2021Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4% Glutamax (Gibco), 1% Sodium Pyruvate (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... claudin-4 (Invitrogen), occludin (Cell Signaling Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... claudin-4 (Invitrogen), occludin (Cell Signaling Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4% B27-(ThermoFisher), 100 µM Palmitate (Sigma) ...
-
bioRxiv - Systems Biology 2021Quote: ... The cells were maintained in fibroblast media for 6 days then passaged onto Matrigel-coated dishes for further reprogramming in Essential 6 medium plus human bFGF (ThermoFisher Scientific). The iPSC colonies were manually picked onto Matrigel-coated plates to generate stable iPSC lines ...
-
bioRxiv - Systems Biology 2021Quote: ... The cells were maintained in fibroblast media for 6 days then passaged onto Matrigel-coated dishes for further reprogramming in Essential 6 medium plus human bFGF (ThermoFisher Scientific). The iPSC colonies were manually picked onto Matrigel-coated plates to generate stable iPSC lines ...
-
bioRxiv - Developmental Biology 2022Quote: ... embedded in paraffin using the Tissue-Tek VIP 6 (Sakura) tissue processor and of 6 µm sections obtained with a microtome (HM355S, Thermo Scientific). Z-shaped probes for Sema6d (565871) ...
-
bioRxiv - Systems Biology 2020Quote: 1×10^6 cells were seeded in wells of 6-well plates (FALCON # 353046) in MEM without phenol red (Gibco # 51200038) supplemented with 0.5% Fetal Calf Serum (VWR #89510-184) ...
-
bioRxiv - Systems Biology 2020Quote: 1×10^6 cells were seeded in wells of 6-well plates (FALCON # 353046) in MEM without phenol red (Gibco # 51200038) supplemented with 0.5% Fetal Calf Serum (VWR #89510-184) ...
-
bioRxiv - Systems Biology 2020Quote: 1×10^6 cells were seeded in wells of 6-well plates (FALCON # 353046) in MEM without phenol red (Gibco # 51200038) supplemented with 0.5% Fetal Calf Serum (VWR #89510-184) ...
-
bioRxiv - Genomics 2021Quote: ... 600,000 cells were plated in 6 well plates and transfected with 2 μg plasmid DNA using 6 μl Lipofectamine LTX reagent (Thermo Fisher). Medium was exchanged after 16 h and harvested 24 h later ...
-
bioRxiv - Microbiology 2023Quote: ... cells were plated at 650,000 cells per well of a 6 well plate and infected with 6 dilutions from a 10-fold dilution series in 1% FBS (Gibco, MA)/1X non-essential amino acids (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... The IL-6 levels in plasma were analyzed using a Mouse IL-6 Uncoated ELISA kit (#88-7064, Invitrogen, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...
-
bioRxiv - Biochemistry 2024Quote: ... Transfection of 1 µg per well of plasmids encoding SARS-CoV-2 tag-free nucleocapsid protein was performed using 6 µL per well of Lipofectamine 2000 on HEK-293T cells with 70-80% confluency on 6-well plates (Invitrogen, 11668027). Compounds were added to the cells with fresh media after 6 hours of incubation with plasmids for 24-hour treatment before cell lysis and immunoblotting ...
-
bioRxiv - Cell Biology 2024Quote: Cells were seeded at 30 000 cells/cm2 and were treated 6 h later with 6 µM of the calcium-sensitive Rhod2AM probe (ThermoFisher Scientific) for 1 h before refreshing the cell culture medium ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR targeting PTPRZ1 (5’-ACTCTGAGAAGCAGAGGAG-3’ and 5’-CTGTTGTCTGTAGTATCCATTAG-3’) or GAPDH (5’-TCAAGGCTGAGAACGGGAAG-3’ and 5’-CGCCCCACTTGATTTTGGAG-3’) was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659) in three technical replicates.
-
bioRxiv - Plant Biology 2020Quote: ... the samples were centrifuged before receiving 50 µL of N-Methyl-M (trimethylsilyl) trifluoroacetamide (MSTFA) + 1% trimethylchlorosilane (TMCS) (ThermoFisher Scientific, Waltham, MA, USA), briefly vortexed and incubated at 60 °C for 40 min ...
-
bioRxiv - Systems Biology 2021Quote: ... the samples were centrifuged before receiving 50 μL of N-Methyl-M (trimethylsilyl) trifluoroacetamide (MSTFA) + 1 % trimethylchlorosilane (TMCS) (ThermoFisher Scientific, Waltham, MA, USA), briefly vortexed and incubated at 60 °C for 40 min ...
-
bioRxiv - Genomics 2020Quote: ... Primers specific for the methylated bisulphite converted DNA (GAGGAGGAGGGGGTTTGTTAT and AAATCAATAACCTAATAACCACACAC) were designed using Methyl Primer Express (Applied Biosystems, Foster City, CA, USA). After PCR amplification ...