Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 3 and 6 h and stained live with 100 nM Lysotracker red DND-99 (Thermo Fisher, L7528) for 1.5 h before ending the treatment ...
-
bioRxiv - Neuroscience 2024Quote: ... After 4 times 5-minute washes in PBS with 0.5 % Tween® 20 (Fisher Scientific #9005-64-5), each slide was again dried around tissue slices and PAP pen was re-applied ...
-
bioRxiv - Cell Biology 2024Quote: ... Stage 4/5 hippocampal neurons (5-11 DIV respectively) were transfected with Lipofectamine 2000 (Thermo Fisher, Cat# 11668019) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... enzymatic dissociation was performed for 4–6 minutes at 37°C in 1 mL TrypLE (Invitrogen), then cell pellets were washed with ice-cold PBS and lysed with 1 mL of TRIzol (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... IFN-γ IL-4 and IL-6 were measured by Mouse Uncoated ELISA Kit (Invitrogen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... enzymatic dissociation was performed for 4–6 min at 37 °C in 1 ml TrypLE (Invitrogen), then cell pellets were washed with ice-cold PBS and lysed with 1 ml of TRIzol (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... 200µL 5-Ethynyl-2’-deoxyuridine (EdU, Molecular probes; 3g/L) was injected intraperitoneally in pregnant females 2 hours before embryo isolation.
-
bioRxiv - Developmental Biology 2020Quote: ... and 5.5 x 10-5 mol/L 2-mercaptoethanol (Gibco). For the endothelial potential assay ...
-
bioRxiv - Cell Biology 2020Quote: ... For 5-ethynyl-2’-deoxyuridine (EdU) incorporation assays (Life Technologies), 10μM EdU was included in culture for two hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5-ethynyl-2′-deoxyuridine (EdU) (Thermo Fisher Scientific, cat. #E10415) was diluted 2.5 mg/ mL in sterile PBS and injected intraperitoneally on days 3 and 4 post-injury at a dose of 10 μL/ g body weight ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; Thermo Fisher Scientific, Waltham, MA) was either injected i.p ...
-
bioRxiv - Cancer Biology 2022Quote: ... or 2 - 5 μg/ml Puromycin Dihydrochloride (Thermo Fisher, # A1113803) until all negative control cells were dead ...
-
bioRxiv - Microbiology 2022Quote: ... or 0.1 mM 5-ethynyl-2’-deoxyuridine (EdU; Life Technologies) was added for the time indicated in the text.
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Thermo Fisher Scientific, Barcelona, Spain) was added for 48h ...
-
bioRxiv - Immunology 2021Quote: ... 5 μM of 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Invitrogen) probe was added to each neutrophil subtype and incubated in the dark for 15 min ...
-
bioRxiv - Biophysics 2020Quote: ... while GRN-5 was expressed in Origami 2 DE3 (Invitrogen) as fusion constructs with a thioredoxin-A and hexa-histidine tag (TrxA-Hisx6-GRN) ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 ml of bovine collagen I (5 mg/ml) (Gibco), and 6.67 ml serum starvation medium were mixed on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... For pulsed EdU (5-ethynyl-2’-desoxyuridine) (Thermo Fisher Scientific) incorporation ...
-
Evolutionary conservation of maternal RNA localization in fishes and amphibians revealed by TOMO-SeqbioRxiv - Developmental Biology 2021Quote: ... and 2 μl of 5 × First strand synthesis buffer (Invitrogen) were added and incubated ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µL TaqMan Universal PCR Master Mix (2×) (Applied Biosystems), and 0.5 µL of each TaqMan Gene Expression Assay reagent ...
-
bioRxiv - Physiology 2022Quote: ... loading buffer containing 5% 2-mercaptoethanol (Fisher Scientific, O3446I-100). Samples were then subjected to SDS-PAGE on NuPAGE Novex 12% Bis-Tris gels (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: Approximately 60 WT and MafAS64F/+ islets from at least 6 female and male mice were analyzed with the ratiometric calcium indicator fura-2-acetoxymethylester (Fura-2 AM) (Life Technologies). Islets were maintained in 5 mM glucose for 30 min prior to measuring 11 mM glucose-induced calcium oscillations and depolarization-activated calcium influx with 30 mM KCl ...
-
bioRxiv - Cell Biology 2020Quote: ... incubated 2-3 minutes with SuperSignalTM West Pico Chemiluminiscent Substrate (Thermo Scientific) and imaged using C-DiGit® Blot Scanner (LI-COR).
-
bioRxiv - Biochemistry 2020Quote: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Thermo Fisher Scientific) was added to cells at a final concentration of 2mM and incubated at 37°C in 5%CO2 for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: ... A predesigned TaqMan assay targeting exon 2–3 boundary (Hs00213726_m1; Life Technologies) was also used to ensure equal amount of the endogenous A4GALT transcript in transfected and non-transfected cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-phospho-Pak1-2-3 (pSer141) (44-940G, 1:2000) from Invitrogen/Thermo Fisher Scientific (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... Jade1/2/3 mRNA was assessed by SYBR Green (Thermo Fisher Scientific) qPCR using Hprt1 as endogenous control ...
-
bioRxiv - Cell Biology 2021Quote: ... phospho-PAK1/2/3 (Thr402) (ThermoFisher PA1-4636, 1:1000 for WB), phospho-PAK4 (Ser474)/PAK5 (Ser602)/PAK6 (Ser560 ...
-
bioRxiv - Cell Biology 2021Quote: ... and were passaged every 2 or 3 days using 0.05% Trypsin (Gibco). mESCs were used at passages below 30 ...
-
bioRxiv - Neuroscience 2020Quote: ... Fibroblasts were fed every 2-3 days with DMEM (ThermoFisher Scientific, #11995073) media supplemented with 10% (v/v ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were passaged once every 2-3 days by trypsinization (Gibco, 25300054) upon reaching ∼70-80% confluency ...
-
bioRxiv - Physiology 2020Quote: ... for 3 days with macrophage-conditioned medium containing 2% Horse Serum (Gibco). Cells were washed ...
-
bioRxiv - Cell Biology 2020Quote: ... spiked with 2-3 μL Plus reagent (15338100, Thermo Fisher Scientific, USA). The plasmid solution was mixed and incubated for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were split every 2 to 3 days using TrypLE Express (Gibco).
-
bioRxiv - Cell Biology 2024Quote: ... and TaqMan assay reagents (Table 2) on the QuantStudio 3 (Applied Biosystems). Gene expression was normalized to GAPDH expression ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: Cells were passaged every 2-3 days by incubation with Accutase (Gibco) for 2-3 min at 37°C ...
-
bioRxiv - Pathology 2022Quote: ... 2 and 3 were quantified using CyQUANT Proliferation Assay Kit (Invitrogen, C35011); For myofibroblast differentiation assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dynabeads with precipitated proteins were washed 3 times with DynaMag-2 (Invitrogen) and eluted with LDS buffer (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... 3) Dyes: NucBlue Live Cell Stain (2 drops/ml, R37605, Molecular Probes), phalloidin-568 (A12380 ...
-
bioRxiv - Cell Biology 2024Quote: ... A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (M2128, Invitrogen) solution was prepared at a final concentration of 0.5 mg/mL and pH 7.4 ...
-
bioRxiv - Genetics 2024Quote: ... transfected cells were selected using 2-3 µg puromycin (Thermo Fisher Scientific) until all cells in non-transfected control were dead ...
-
bioRxiv - Neuroscience 2024Quote: ... This medium was exchanged 2-3 hours after plating with Neurobasal (Gibco) supplemented with L-glutamine (2 mM) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Media was changed daily and the cells passaged every 3–4 days at a ratio of 1:4 using the StemPro EZPassage tool (ThermoFisher Scientific).
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...