Labshake search
Citations for Thermo Fisher :
1951 - 2000 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... The supernatant was exchanged with 500 µL 2% paraformaldehyde in phosphate-buffered saline (PBS) (Thermo Fisher Scientific, United States). The samples were left at room temperature for 30 minutes to 2 hours for fixating ...
-
bioRxiv - Immunology 2024Quote: ... and blocked from 20 min in ice-cold FACS buffer (2% fetal calf serum in Dulbecco’s Phosphate Buffered Saline (Gibco) supplemented with 2.5 mM EDTA (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... Briefly, blood was diluted with 2% Fetal Calf Serum (FCS) (Biowest,, #S181T) in Phosphate-Buffered Saline (PBS) (Thermofisher, 10010056) and gently transferred on top of the density gradient medium layer in SepMate tubes (Stemcell ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were incubated with 4 μM fura-2 acetoxymethyl ester (fura-2/AM, Invitrogen, Cat# M1291) in HEPES-buffered solution (137 mM NaCl ...
-
bioRxiv - Cell Biology 2024Quote: ... slides were washed in PBS 3×5 minutes and then stained with the secondary antibody Goat anti-rabbit AlexaFluor555 (Invitrogen #A21429, working concentration 2 µg/µl) or Goat anti-rat Alexa488 (Thermofisher #A-11006 ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were subjected to Pierce PES 2-6 mL concentrator columns (Thermo Fisher Scientific) to further desalt the sample ...
-
bioRxiv - Cell Biology 2023Quote: ... The media was changed after 2 days to Essential 6 (Invitrogen Cat. No. A1516401) supplemented with b-FGF 20ng/mL (Peprotech US ...
-
bioRxiv - Neuroscience 2022Quote: ... 2×10^6 single cell H9s were pre-incubated with Revitacell® (Life Technologies) and nucleofected using the Amaxa nucleofector II on setting F16 with 2.5μg CRISPR/Cas9 ...
-
bioRxiv - Bioengineering 2023Quote: ... we dissociated 2×10^6 cells into single-cells with StemPro Accutase (ThermoFisher Scientific). We complexed the sgAlt-R® S.p ...
-
bioRxiv - Cell Biology 2023Quote: ... pre-coated 6-well plates with 2 mL TeSR-E8 medium (Life Technologies, 05990) at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... The wells were then washed 5 times with phosphate-buffered saline (PBS) + 0.05% Tween 20 and blocked with SEA BLOCK blocking buffer (Thermo Scientific) in the first panning round and 5% milk powder in PBS in the second panning round ...
-
bioRxiv - Biophysics 2020Quote: ... for 5 min at room temperature and washed twice with phosphate buffered solution (1×, pH 7.4, Gibco, Thermo Fisher Scientific). The microchips were then coated with fibronectin (15 μg/mL ...
-
bioRxiv - Biophysics 2020Quote: ... for 5 min at room temperature and washed twice with phosphate buffered solution (1×, pH 7.4, Gibco, Thermo Fisher Scientific). The microchips were then coated with fibronectin (15 μg/mL ...
-
bioRxiv - Immunology 2022Quote: ... Cells were centrifuged at ~300g for 5 minutes at room temperature and washed twice in 5ml of prewarmed DPBS (Dulbecco’s phosphate-buffered saline) (Gibco: 14190250) and subsequently seeded at 0.25*106 cells/ml in IMDM ...
-
bioRxiv - Pathology 2021Quote: ... pellets were resuspended in 50μl of 5% SDS containing phosphate buffered saline and cytoplasmic fractions were mixed 1:1 with 10% SDS solution (Thermofisher) to give a final 5% SDS concentration ...
-
bioRxiv - Immunology 2024Quote: ... followed by incubation with blocking solution (Goat serum, dilution 5:100 in Phosphate Buffered Saline Tween20,PBST, 0.05%, Fisher Scientific) for 1hour at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then washed twice with phosphate-buffered saline (PBS) and pre-incubated with 5 Mitotracker Red (Thermo Fisher Scientific) in PBS for 15 min at 37°C in the dark ...
-
bioRxiv - Synthetic Biology 2022Quote: ... supplemented with 5% HyClone fetal bovine serum (FBS) (Cytiva Life Sciences, #SH30084.03, AU origin) and 10% tryptose phosphate broth (TPB) (ThermoFisher, #CM0283B), referred to as BHK-21 Growth Medium ...
-
bioRxiv - Genetics 2024Quote: ... from male 3rd instar larvae were dissected in cold phosphate buffer saline (PBS) and incubated with 5 μM of MitoSOX Red (Invitrogen) for 30 min at room temperature (RT) ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-aagaattggagggaccaccccc-3’ (underline is the codon change T to R) and 5-tgtcacgcgctcaaagtggttg-3’ using the fusion DNA polymerase (Thermofisher). After treating the PCR products with DpnI (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Developmental Biology 2024Quote: ... and passaged every 3–5 days after approximately 5 minutes of incubation with 0.5 mM EDTA (15575020, Life Technologies).
-
bioRxiv - Neuroscience 2022Quote: ... cells were loaded in microglia differentiation medium with 3 μM Fluo-4 AM and 3 μM Fura-Red AM (Molecular Probes) in the presence of Pluronic Acid F-127 (Molecular Probes ...
-
bioRxiv - Cell Biology 2022Quote: ... Blocks of tissue of ~3×3×4 cm (depth×width×height) were cut and prepared for sectioning using a Vibrating Blade Microtome (Thermo Fisher) at a thickness of 500μm ...
-
bioRxiv - Bioengineering 2023Quote: Passage 3 and passage 4 cells from 8 donors (4 male and 4 female) were expanded in T175 flasks (Thermo Fisher Scientific, Hampton, New Hampshire USA) and were cultured until passage 5 (p3-5 and p4-5 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5% (by volume) fluorescent bead solution (6 μm FocalCheck Microspheres; part no. F14807; ThermoFisher), prepared using deionized water ...
-
bioRxiv - Bioengineering 2021Quote: ... 6-well well-plates were first coated with vitronectin (5 μg/mL, Thermo Fisher, USA) followed by a coating with 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2022Quote: ... Single disks containing either 5 mg BA or 25 μg FLC (6 mm, Fisher Scientific) were placed in the center of the MH plates ...
-
bioRxiv - Cell Biology 2022Quote: ... Metabolically labeled NSPs were conjugated to tetramethylrhodamine 5-carboxamido-(6-azidohexanyl) (TAMRA-N3, Invitrogen, T10182) via CuAAC ...
-
bioRxiv - Immunology 2024Quote: ... 1 µM or 0.4 µM of 5(6)-carboxyfluorescein diacetate succinimidyl ester (CFDA-SE; Invitrogen), which is metabolized within cells to carboxyfluorescein succinimidyl ester (CFSE) ...
-
bioRxiv - Bioengineering 2020Quote: ... Plates were sterilised by submerging in a 70% ethanol solution for a minimum of 30 minutes and rinsed 3 times with phosphate buffered saline (PBS; Thermo Fisher Scientific). Prior to cell seeding ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were fixed with 4% (w/v) paraformaldehyde (Nisshin EM, Tokyo, Japan)/Dulbecco’s phosphate-buffered saline (DPBS) (Thermo Fisher Scientific) for 5 min at 24–26 °C and rinsed with DPBS ...
-
bioRxiv - Neuroscience 2020Quote: Cortical slices were fixed in 4% PFA (prepared from 16% PFA stocks in phosphate buffered saline according to manufacturer’s instruction, Thermo Scientific, #28908) at room temperature and stored at 4°C overnight in the same solution ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were fixed by perfusing 10% phosphate buffered formalin (Fisher, SF100-4) for 30 minutes followed by a 60-minute wash with dPBS (ThermoFisher, 14040133). The devices were stored at 4 degrees Celsius for not more than 2 weeks before further processing ...
-
bioRxiv - Cell Biology 2022Quote: ... the base and apex of the heart were amputated and the lesioned segment was immersed for 16 hours in 4 % formaldehyde in phosphate-buffered saline solution (28906, Thermo Fisher). The specimen was then immersed overnight at 4 °C in 30 % sucrose solution ...
-
Prevention of tau accumulation through inhibition of hnRNP R-dependent axonal Mapt mRNA localizationbioRxiv - Neuroscience 2023Quote: ... Cells were washed three times with RNase-free DPBS and fixed for 10 min in paraformaldehyde lysine phosphate (PLP) buffer (pH7.4) containing 4% paraformaldehyde (PFA) (28908, Thermo Fisher Scientific), 5.4% glucose and 0.01 M sodium metaperiodate ...
-
bioRxiv - Cancer Biology 2024Quote: ... Adult female intestines were dissected in PBS (Phosphate buffered saline, P3812-10PAK) and transferred to Polylysine slides and fixed in 4% Paraformaldehyde (16 % Paraformaldehyde (Thermo Scientific) diluted in PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by isoflurane inhalation until no response to noxious stimulus) followed by transcardial perfusion with 4% paraformaldehyde in phosphate buffered saline (PBS) (Thermo Fisher) and brain extraction ...
-
bioRxiv - Neuroscience 2023Quote: Third instar larval brains were dissected in phosphate buffered saline (PBS) and fixed with 4 % formaldehyde (FA) pH 7 (Thermo Scientific)/PBS for 20 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... Adult female intestines were dissected in PBS (Phosphate buffered saline, P3812-10PAK) and transferred to Polylysine slides and fixed in 4% Paraformaldehyde (16 % Paraformaldehyde (Thermo Scientific) diluted in PBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... On day 3-9 cells were fed daily with Essential 6 medium (E6, #A1516401, Thermo Fisher Scientific) in the presence of 100 nM LDN193189 (#72142 ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated with 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) substrate (ABTS, Thermo Fisher Scientific) for 15 min at RT shielded from light and absorbance was measured at optical density (OD ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 and 8 weeks of maturation were loaded with 2.5 µM Fluo-3-AM (Molecular Probes, #F1242) dissolved in differentiation medium for 30 min at 37 °C and at 5% CO2 ...