Labshake search
Citations for Thermo Fisher :
1951 - 2000 of 10000+ citations for rno mir 125b 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The qPCR was performed on a 7300 RT-PCR system (Applied Biosystems, Waltham, MA, United States) with the amplification setup of an initial start for 10 min at 95 °C followed by 40 amplification cycles with denaturation at 95 °C for 5s ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed on the 7500 Fast or StepOnePlus Real-Time PCR System (Thermo Fisher), following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... viral cDNA was synthesized with the SuperScript IV First-Strand Synthesis System for RT-PCR (Invitrogen) using 100 units of SuperScript IV reverse transcriptase and a combination of S ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The RT-PCR reaction was performed using a QuantStudio™ 7 Flex system (Thermo Fisher Scientific) and data analysis was performed using the manufacturer’s web-based software (https://geneglobe.qiagen.com/analyze) ...
-
bioRxiv - Pathology 2022Quote: ... RT-qPCR were performed on an ABI Q3 Real-time PCR Detection System (Applied Biosystems, USA) under the following conditions ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesis was performed using the SuperScript III First-Strand RT-PCR Kit (Thermo Fisher Scientific) with an oligo-dT primer based on the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and the reverse transcription was performed using Superscript FirstStrand Synthesis for RT-PCR (Invitrogen, CA, USA). cDNA was amplified using the Master Mix kit (Thermofisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... one-step RT-qPCR was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems) using the Luna Universal One-Step RT-qPCR Kit (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative real-time RT-PCRs were performed in a QuantStudio 7 Flex System (Thermo Fisher Scientific) using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR reactions were performed on QuantStudio 12 K Flex Real-Time PCR System (Applied Biosystems) and analyzed with the QuantStudio 12 K Flex Applied Biosystems software v1.2.3 ...
-
bioRxiv - Genomics 2024Quote: ... cDNA synthesis was performed using the SuperScript III First-Strand RT-PCR Kit (Thermo Fisher Scientific) with an oligo-dT primer based on the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... RT-qPCR was performed using a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific) per manufacturer methods and as previously published49 ...
-
bioRxiv - Plant Biology 2022Quote: Quantitative reverse transcription PCR (RT-qPCR) was done with SYBR Select Master Mix (Thermo Fisher Scientific) on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was carried out using a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) and KAPA SYBR Fast qPCR reagents (KAPA Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... 0,2 ml SuperScript TM III RT/PlatinumR Taq Mix (Invitrogen, CellsDirect one-step qRT-PCR kit), 1.2 mL TE buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... Gene expression was analyzed by quantitative RT-PCR using Taqman Gene Expression Assays (Applied Biosystems, 4369016) directed against the mouse targets β-glucuronidase (Mm00446953_m1) ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using Power SYBR Green PCR Master Mix (Thermo Fisher Scientific, Cat# 4367659). Primers for each A3 mRNA have been reported previously (70 ...
-
bioRxiv - Genetics 2023Quote: ... quantitative RT-PCR analysis was performed using iTaq Universal SYBR® Green Supermix (Thermo Fisher Scientific) on a Thermo Fisher Quantstudio 7 flex Momentum machine according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR was performed by High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) using random primers and following standardized protocols ...
-
bioRxiv - Immunology 2023Quote: ... The RT-PCR was carried out using the ABI StepOnePlus thermocycler (Life Technologies, Grand Island, NY). The S-N501Y ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was run in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific 4453545) with cycle settings following manufacturer’s protocols for the RT-qPCR kit ...
-
bioRxiv - Immunology 2023Quote: ... The RT-PCR was carried out using the ABI StepOnePlus thermocycler (Life Technologies, Grand Island, NY). When the Ct-value was relatively high (35 ≤ Ct < 40) ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative RT-PCR reactions were prepared using a SYBR Green Master Mix kit (Thermo Fisher Scientific) and conducted in a CFX384 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA or RT-PCR was synthesized using the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific). Sanger sequencing was performed according to standard procedures.
-
bioRxiv - Cell Biology 2023Quote: ... Cellular or kidney RNA was then reverse-transcribed using an RT-PCR kit (Superscript III; Invitrogen). Gene expression was evaluated by quantitative real-time PCR ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR reactions were performed on the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) using SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: RT-qPCR was performed with a StepOnePlus™ Real-Time PCR System (ThermoFisher Scientific, Waltham, MA). Forward and reverse primers ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNAs were synthesized from extracted RNA by using Superscript III First Strand RT-PCR kit (Invitrogen). Real-time quantitative PCR amplifications were performed on CFX96 Touch Real-time PCR detection system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: FAP21 cDNA was obtained by RT-PCR on total RNA isolated using TRIzol (Invitrogen, 15596-026) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... real-time quantitative PCR (RT-qPCR) was performed using TaqMan Fast Advanced Master Mix (Applied Biosystems) and the following primers which were all purchased from Applied Biosystems ...
-
bioRxiv - Pathology 2023Quote: ... cDNA synthesis was performed using the SuperScript III First-Strand RT-PCR Kit (Thermo Fisher Scientific) with an oligo-dT primer based on the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... RT-qPCR reactions were conducted on the Viia 7 Real-time PCR System (Applied Biosystems, USA) with SYBR Premix Ex TaqTM II (TaKaRa ...
-
bioRxiv - Physiology 2023Quote: ... RT-qPCR was performed in a QuantStudioTM 5 Real-Time PCR System (Applied Biosystems, Massachusetts, USA). Genes were amplified employing the AceQ ® qPCR SYBR Green Master Mix (NeoBiotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cDNA was synthesized using the Superscript III First-Strand Synthesis System for RT-PCR (Invitrogen). Probes for EPB41 and actin beta transcripts (EPB41_1_For AACTTCCCAGTTACCGAGCA ...
-
bioRxiv - Neuroscience 2023Quote: RT-qPCR was performed in a QuantStudioTM 5 Real-Time PCR System (Applied Biosystems, Massachusetts, USA). Genes were amplified employing the AceQ® qPCR SYBR Green Master Mix (NeoBiotech ...
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR: Reverse transcription were performed using SuperScript IV RT (Thermo Fisher Scientific, Waltham, MA, USA) and qRT-PCR using appropriate primers (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-qPCRs were carried out on a Quantstudio 3 Applied Biosystems real-time PCR system (ThermoFisher) using either fast SYBR green master mix (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR was conducted by using SYBR Green real-time PCR master mix (ThermoFisher, cat#: A25778) in 20 μl reactions using standard reaction conditions (50℃/2min ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative RT-PCR (qPCR) was carried out by PowerUp SYBR Green Master Mix (Thermo Fisher, A25778) using qTOWER3 G (Analytikjena) ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative RT-PCR (qPCR) was performed using PowerUp™ SYBR™ Green Master Mix (Applied biosystems). Three biological replicates and two technical replicates per sample per gene were performed ...
-
bioRxiv - Biochemistry 2024Quote: ... Quantitative RT-PCR was performed using the TaqMan RNA-to-CT 1-Step kit (ThermoFisher Scientific). Briefly ...
-
bioRxiv - Immunology 2024Quote: ... cDNA was generated using the SuperScript III First-Strand Synthesis System for RT-PCR kit (Invitrogen) and the mCy1-cDNA primer ...
-
bioRxiv - Developmental Biology 2024Quote: ... Quantitative RT-PCR was performed in triplicate wells using Power SYBR Green Master Mix (Applied Biosystems) with the 7900HT Sequence Detection System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2021Quote: ... or miR-544-3p inhibitor (50 nM; Thermo Fisher Scientific, Waltham, MA), or negative control mimic (50 nM ...
-
bioRxiv - Neuroscience 2019Quote: ... using the BLOCK-iT Pol II miR RNAi expression vector kit (Invitrogen). The vector construct contained an engineered miR sequence to drive Gpr88 knock-down ...
-
bioRxiv - Cancer Biology 2020Quote: ... the cells were transfected with Anti-hsa-mir-7704 inhibitor AM29132 (ThermoFisher) according to manufacturer’s instructions at 100 nM for 48 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... hsa-miR-494-3p inhibitor (MIMAT002816) (Cat 4464084, Assay ID MH12409, Ambion). Negative Control LNA mimic (Cat ...
-
bioRxiv - Cell Biology 2020Quote: ... hsa-miR-494-3p mimic (MIMAT002816) (Cat 4404066, Assay ID MC12409, Ambion), mirVana miR inhibitor negative control #1 (Cat 4464076 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pre-miR™ Negative Control #2 (Thermo Fisher Scientific, Waltham, MA, USA) was used to represent the negative control ...
-
bioRxiv - Physiology 2022Quote: ... Mature miR-29b expression was assayed using TaqMan MicroRNA Assays (Applied Biosystems). Briefly ...