Labshake search
Citations for Thermo Fisher :
1901 - 1950 of 10000+ citations for rno mir 125b 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: cDNA was generated using the Superscript III First-Strand Synthesis System for RT-PCR Kit (Invitrogen) per manufacturer’s instructions and all qRT-PCR was performed on a CFX Connect Real-Time System (Bio-Rad ...
-
bioRxiv - Developmental Biology 2021Quote: Quantitative real-time RT-PCR was performed using an ABI Prism 7500 Fast SDS (Applied Biosystems). Total RNA was extracted using NucleoSpin RNAII kit (Takara ...
-
bioRxiv - Molecular Biology 2021Quote: ... quantitative RT-PCR was performed using a SYBR Green Master Mix (Applied Biosystems, Foster City, CA) and primer pairs for sodium phosphate cotransporters ...
-
bioRxiv - Molecular Biology 2020Quote: qPCR reactions were carried out using a Step-One Plus RT-PCR thermal cycler (Applied Biosystems), Luna Universal qPCR Master Mix (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... The amplification process was done using SuperScript ™ IV One-Step RT-PCR System kit (Invitrogen) as follows ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total RNA was reverse transcribed using SuperScript™ First-Strand Synthesis System for RT- PCR (Invitrogen) with oligo-d(T ...
-
bioRxiv - Neuroscience 2019Quote: ... RT-qPCR reactions were run on an ABI 7500 Fast Real-Time PCR system (Applied Biosystems) with the following conditions ...
-
bioRxiv - Microbiology 2020Quote: ... and RT-qPCR was performed using SYBR® Green Real-Time PCR Master Mixes (Invitrogen™) and the StepOnePlus Real System (Applied Biosystems™) ...
-
bioRxiv - Immunology 2020Quote: ... and amplified with the SuperScript III Platinum one-step quantitative RT-PCR system (Thermo Fisher Scientific). Samples were then run on a LightCycler480 (Roche ...
-
bioRxiv - Immunology 2019Quote: ... and RT-PCR was performed using the SuperScript™ III First-Strand Synthesis System kit (Invitrogen). Quantitative RT-PCR was performed using the Fast SYBR™ Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2019Quote: ... RT-qPCR reactions were run on an ABI 7500 Fast Real-Time PCR system (Applied Biosystems) with the following conditions ...
-
bioRxiv - Genomics 2021Quote: ... RT-qPCR was performed using an ABI 7500 Real-Time PCR system (Applied Biosystems, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription was performed using the SuperScript™ III One-Step RT-PCR System (Invitrogen, 12574026) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCRs were run in a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). Relative quantification was determined using the ΔΔCt method and normalized to the endogenous controls RPLP0 and GAPDH (GAPDH FWD 5’-3’= GTTCGACAGTCAGCCGCATC ...
-
bioRxiv - Cell Biology 2021Quote: ... and RT-qPCR was performed using Power SYBR™ Green PCR Master Mix (ThermoFisher Scientific, 4367659), on CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... The relative expression values were analyzed using the SYBR Prime Script RT-PCR kit (Thermo Scientific) in ABI PRISM 7500 Fast (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... RT-PCR reactions were applied to the PowerUp SYBG Green Master Mix Kit from Applied Biosystems, USA ...
-
bioRxiv - Microbiology 2019Quote: ... and cDNA was synthesized by RT-PCR using a SuperScript® VILOTM cDNA Synthesis Kit (Invitrogen). The coding regions of the H and L chains of M2 and M4 were amplified by PCR using KOD-Plus-Neo (TOYOBO ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by RT-qPCR analysis with SYBR green PCR master mix (Thermo Fisher; Cat. No. 4309155) on a QuantStudio™ 7 Flex Real-Time PCR System ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR was performed by High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) using random primers and following standardized protocols.
-
bioRxiv - Microbiology 2022Quote: ... Individual 5’ RACE and RT-PCR products were cloned into the pCR2.1 TA cloning vector (Invitrogen) and sequenced.
-
bioRxiv - Molecular Biology 2022Quote: RT-qPCR experiments were performed with Power SYBRR® Green PCR Master Mix (Thermo Fisher Scientific) using a 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was quantified by RT-qPCR on a StepOnePlus Real-Time PCR System (Applied Biosystems) using TaqMan Fast Virus 1-Step Master Mix chemistry (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The RT-qPCR reaction was also performed using the StepOne real-time PCR system (Applied Biosystems) with the KOD SYBR qPCR Mix (Toyobo Co ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was generated using the Superscript III One-Step RT-PCR system (Invitrogen, Carlsbad, CA, USA). Standard PCR followed ...
-
bioRxiv - Plant Biology 2021Quote: ... The RT-qPCR were performed in the QuantStudio® 3 Real-Time PCR System (Applied Biosystems) using the SYBR® Green detection system ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed in triplicate using the Power SYBR Green PCR master mix (Thermo Fisher) and the QuantStudio 6 Flex RT-PCR systems ...
-
bioRxiv - Microbiology 2020Quote: ... Viral RNA was quantified by RT-qPCR (qRT-PCR EXPRESS One-Step Superscript™, ThermoFisher Scientific) (10min-50°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was then produced using the SuperscriptIII first strand synthesis system for RT-PCR (Life Technologies).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... according to the manufacturer’s instructions on the AB1 StepOne RT-PCR system (Ambion, Foster City, CA). Relative quantification of target gene along with internal control was calculated using the comparative cycle threshold method (2-ΔΔCT).
-
bioRxiv - Synthetic Biology 2020Quote: ... RT-PCR products obtained from round 13 were cloned with TOPO TA Kit (Invitrogen; Carlsbad, CA) according to the manufacturer’s indications ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNAs were synthesized from extracted RNA by using Superscript III First Strand RT-PCR kit (Invitrogen). Real-time quantitative PCR amplifications were performed on CFX96 Touch Real-time PCR detection system (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Real-time RT-PCR was performed in a StepOne plus system (ABI StepOne Plus, ThermoFisher, USA) using SYBR green master mix (cat ...
-
bioRxiv - Genetics 2020Quote: ... The RT-qPCR was performed in triplicate using 2X SYBR green PCR master mix (Applied Biosystems) with a QuantStudio TM 5 flex system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... The samples were run using the default protocol in QuantStudio 3 RT-PCR machine (Applied Biosystems). Fold-changes were calculated using the 2−ΔΔCt method (128) ...
-
bioRxiv - Molecular Biology 2021Quote: RT-PCR was conducted on equal volumes (3ul) of each fraction using SuperScript III (Invitrogen 18080085). qPCR was then conducted using SYBR Green master mix (Applied Biosystems 4385618 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The duplex assay used the Applied Biosystems AgPath-ID One-Step RT-PCR kit (ThermoFisher, Australia) and distinguishes prototype and variant HeV strains ...
-
bioRxiv - Microbiology 2020Quote: ... with the AgPath-ID One-Step RT-PCR Kit (Applied Biosystems life technologies, Waltham, MA, USA). RNA dilutions from purified SARSr-CoV-RsWIV1 stock were used as a standard (with a titer of 6.5 × 106 PFU/mL) ...
-
bioRxiv - Microbiology 2019Quote: ... All Q-RT-PCR reactions were performed in triplicate with an ABI Prism 7900HT (Applied Biosystems) using iTaq SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Genomics 2021Quote: ... SARS-CoV-2 RT-qPCR was performed in a 7500 Real-Time PCR System (Applied Biosystems) using Seegene-Allplex 2019-nCoV Assay ...
-
bioRxiv - Physiology 2020Quote: ... Gene expression levels of SIRT3 was determined by RT-PCR on an ABI7900HT machine (Applied Biosystems) using TaqMan primers (SIRT3 ...
-
bioRxiv - Cell Biology 2021Quote: ... RT–PCR was performed using an ABI Prism 7900HT instrument (Applied Biosystems, Foster City, CA, USA) in 384-well plate format with SYBR Green I chemistry and ROX internal reference (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was synthesized from the extracted platelet RNA using VILO SuperScript for RT-PCR (Life Technologies). Target genes were rationally selected as candidates based on their specificity to platelets ...
-
bioRxiv - Biochemistry 2021Quote: ... The RNA was reverse transcribed with SuperScript™ III One-Step RT-PCR System (Thermo Fisher). Real-time RT-PCR experiments were performed using a Power SYBR™ Green PCR Master Mix (Thermo Fisher) ...
-
bioRxiv - Immunology 2020Quote: ... the Maxima First Strand cDNA Synthesis Kit for real-time quantitative PCR (RT-qPCR; Thermo Fisher) was used ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time RT-PCR was conducted with TaqPath 1-Step Multiplex Master Mix (ThermoFisher Scientific, USA) and total RNA isolated by TRIzol LS reagent from individual oral swabs and feces samples.
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative-RT-PCR was performed by using a SYBR Green master mix (Applied Biosystems, Carlsbad, CA). Normalization of gene expression was performed by using the ΔΔCt method and statistical analysis by t testing ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed on a Piko real 96 Real-time PCR System (Thermo Scientific, USA). 16S rRNA was used for normalization of mRNA expression ...
-
bioRxiv - Microbiology 2022Quote: ... and RT-PCR was performed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, #4368813) following the manufacturers protocol ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed in triplicate using the Power SYBR Green PCR master mix (Thermo Fisher) and the Applied Biosystems QuantStudio 6 Flex RT-PCR system ...