Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 6 METHOXY 1 3 BENZODIOXOL 5 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA),3,3’-dihexyloxacarbocyanine iodide [DiOC6(3)] and N-[4-[6-[(acetyloxy)methoxy]-2,7-difluoro-3-oxo-3H-xanthen-9-yl]-2-[2-[2-[bis[2-[(acetyloxy)methoxy]-2-oxoethyl]amino]-5-methylphenoxy]ethoxy]phenyl]-N-[2-[(acetyloxy)methoxy]-2-oxoethyl]-,(acetyloxy)methyl ester (Fluo-4 AM) were purchased from Molecular Probes (Invitrogen, Eugene, OR, USA). Agarose was obtained from Lonza (Walkersville ...
-
bioRxiv - Cell Biology 2019Quote: ... methoxy]-2-oxyethyl] amino]-5-methyl-phenoxy] ethoxy]phenyl-N-[2-[(acetyloxy) methoxy]-2-oxyethyl]-(acetyloxy) methyl ester (Fluo-4/AM) were from Molecular Probes (Invitrogen, Eugene, OR, USA). M ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies ...
-
bioRxiv - Genetics 2022Quote: ... mcherry: 5’-ATGGTGAGCAAGGGCGAGGAG-3’ and 5’-CTTACTTGTACAGCTCGTCCATG-3’) from pKHR8-foxc1aKI and separately subcloned into pJET2.1 (ThermoFisher) to give pJET-mVenus and -mCherry ...
-
bioRxiv - Neuroscience 2024Quote: ... The siRNA sequence for YTHDF2 is 5′-AAGGACGTTCCCAATAGCCAA-3′ and for HIF1α is 5’-GCTGATTTGTGAACCCAT-3’ (Ambion). After 48 h from the initial transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μL the corresponding amine-based tandem mass tag (TMT) 10-plex reagents (10 μg/μL) (Thermo Fisher Scientific, Cat # 90406) was added and incubated for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... Arrays were generated by printing purified proteins onto aminosilane coated slides with printing buffer containing an amine-to-amine homobifunctional crosslinker (bissulfosuccinimidyl suberate, BS3, Thermo Scientific Pierce(tm) Cat # A39266 ...
-
bioRxiv - Pathology 2022Quote: ... resulting from UA were determined via a membrane-permeant JC-1 dye (5, 50, 6, 60 -tetrachloro-1, 10,3,30 -tetraethylbenzimidazol-carbocyanine iodide, Molecular Probes). JC-1 dye accumulates in mitochondria in a potential-dependent manner ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... was co-transfected with either pre-gRNA or gRNA expression plasmids (1 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were first transfected with the pcDNA3_CasRx-GFP plasmid (2.5 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The pbf1 gene of johansen Standard was amplified with the primer pair psbNRO_F 5’-AGCATTGGGAGGCTCATTAC-3’ and psbNRO_R 5’-GGAAACAGCAACCCTAGTCG-3’ and cloned into to pCRTM2.1-TOPO® (Invitrogen). The vector was linearized with HindIII and in vitro transcription was performed according to the suppliers’ protocol ...
-
bioRxiv - Microbiology 2020Quote: ... RdRp_rev 5’-CAAATGTTAAAAACACTATTAGCATA-3’ RdRp_probe 5’-FAM-CAGGTGGAACCTCATCAGGAGATGC-TAMRA-3’) and/or TaqMan gene expression assays (Applied Biosystems) for ACTB (Hs99999903_m1) ...
-
bioRxiv - Immunology 2022Quote: ... and their corresponding FAM-labelled MGB probes (εGLT: 5′-AGGCACCAAATG-3′ and γ1GLT: 5 ′-CTCAGCCAGGACCAAG-3′) (Applied Biosystems) were designed in house ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’- CCACCCTCCAGCCAATC-3’ and FAM/ZEN-labeled probe 5’-ACAGGGCAACCATTGGCTCG-3’ with Taqman Gene Expression Master Mix (ThermoFisher).
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Microbiology 2023Quote: The embB region containing codon 406 was amplified using PCR primers F1 5’-TGATATTCGGCTTCCTGCTC-3’ and R1 5’-TGCACACCCAGTGTGAATG-3’ designed using Primer3 (23) (version 0.4.0) and acquired from ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... was mixed with 5/6 TAMRA-OSu (Thermofisher #C1171) in DMSO ...
-
bioRxiv - Immunology 2020Quote: ... 5% CO2 for 6 days in RPMI (Life Technologies) supplemented with [5%] AB serum ...
-
bioRxiv - Biochemistry 2024Quote: ... NHS-5/6-carboxyfluorescein (NHS-fluorescein, Thermo Fisher 46410), NHS-Oregon Green (Thermo Fisher O6147) ...
-
bioRxiv - Neuroscience 2019Quote: ... After 3 washes Hoechst 33258 nuclear stain (ThermoFisher H3569, 1:1500 for 5 min) was used to counter stain the nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP7 siRNA: 5’-GCAACACUUAGAAGGAGAAGGCCUA-3’ (1362318, Invitrogen); GTPBP8 siRNA#1 ...
-
bioRxiv - Cell Biology 2023Quote: DCAF5 5‘-GCAGAAACCUCUACAAGAAdTdT-3’ (Ambion, silencer select)
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... amine-based fixable live/dead solutions (Life Technologies, Cat. #L23101) were added to cell media of living LECs after 48 hours of drug treatment and five random images were taken of each well ...
-
bioRxiv - Microbiology 2021Quote: Wells of amine-reactive maleic anhydride-derivatized plates (Thermo Scientific) were coated overnight with recombinant SARS-CoV-2 Receptor binding domain (SARS-CoV-2 S protein RBD ...
-
bioRxiv - Cell Biology 2021Quote: ... Yellow amine-reactive live/dead cell dye (Thermo Fisher, L34959) was used for live/dead discrimination ...
-
bioRxiv - Immunology 2020Quote: ... Aqua live/dead amine reactive dye (Life Technologies, Carlsbad, CA) was used for dead cell exclusion ...
-
bioRxiv - Neuroscience 2021Quote: ... or Fluoro-Ruby (tetramethylrhodamine) conjugated to dextran amine (FR; Invitrogen) (Table 1) ...
-
bioRxiv - Biophysics 2022Quote: ... we labeled Rubisco with amine-reactive Alexa 488 (Invitrogen, A10235) and removed free dyes using Micro BioSpin 30 chromatography column ...
-
bioRxiv - Immunology 2023Quote: ... Amine-reactive Alexa FluorTM 555 NHS ester (Thermo Fisher Scientific) was added to IgG samples to final concentrations of fluorochrome 40 μM and incubated for 1 hour at room temperature with constant gentle agitation ...
-
bioRxiv - Neuroscience 2023Quote: ... for antibodies or ArC Amine Reactive Compensation Beads (ThermoFisher, #A1034) for the LIVE/DEAD dye.
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Neuroscience 2020Quote: Neocortex from C57Bl/6 pups (postnatal day 1-3) was dissected in Hibernate-A medium (#A1247501, Gibco, USA), digested with papain (#LS003124 ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5-6 pieces per well were cultured in a 6-well culture plate (Fisher Scientific). For up to two weeks tissue pieces were cultured in Advanced Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...