Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 METHOXY 1 3 BENZODIOXOL 5 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... then adding 15 µL of methoxy amine in pyridine (MOX) (Thermo Fisher) and incubating at 40°C for 90 min ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Neuroscience 2021Quote: ... dextran amine-tetramethylrhodamine (3 kDa; 12% in saline; Molecular Probes) was pressure injected unilaterally into the AON tract projecting to nIII ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2020Quote: ... An anterograde tracer of 5% biotinylated dextran amine (BDA; Invitrogen) was used in some cases ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 kDa methoxy-poly(ethylene glycol)-succinimidyl valerate (mPEG-SVA) (ThermoFisher Scientific, Waltham, MA), 0.1 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Neuroscience 2023Quote: ... Injections were also performed using dextran amine-tetramethylrhodamine (3 kDa; Molecular Probes). Alternatively ...
-
bioRxiv - Neuroscience 2022Quote: ... mixed with 5% biotinylated dextrane amine (BDA, MW: 10.000, Molecular Probes: D1956 ...
-
bioRxiv - Neuroscience 2021Quote: ... TMT10-plex amine reactive reagents (Thermo Fisher, 5 mg per vial) were re-suspended in 1024 μL anhydrous acetonitrile and 25 μL of reagent was added to each sample (TMT label ...
-
bioRxiv - Cancer Biology 2020Quote: ... n = 3) or oligopyridylamides (5 µM ADH-1 or ADH-6, n = 3) using a combination of both TriZol (Thermo Fisher Scientific) and RNAeasy Mini Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Neuroscience 2021Quote: ... biotinylated dextran amine tracer (BDA; 3 kD version; Life Technologies Ltd, Paisley, UK), and (iv ...
-
bioRxiv - Bioengineering 2020Quote: ... amine-functionalized magnetic beads (Dynabeads™ M-270 Amine, Invitrogen) were washed and resuspended in PBS prior to coupling ...
-
bioRxiv - Neuroscience 2020Quote: ... of biotinylated dextran amine (BDA; 10,000 molecular weight, 5% in water, Invitrogen). Injections of BDA were performed stereotaxically and at two depths (0.3 mm and 0.5 mm ...
-
bioRxiv - Neuroscience 2023Quote: ... and 5% fluorescent dextran amines (3,000 MW; Life Technologies Corporation, Carlsbad, CA) in 0.9% saline ...
-
bioRxiv - Cell Biology 2019Quote: ... siPORT Amine (Ambion) was used as a transfection agent (siRNA target sequences in Supplemental Table 1) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The peptides were then labeled with the amine-based TMT 6-plex reagents (Thermo Fisher) for 1 hr at RT ...
-
bioRxiv - Neuroscience 2020Quote: Fluorescent dextran-amines 3,000 MW rhodamine-dextran-amine (RDA) and 3,000 MW fluorescein-dextran-amine (FDA) (Invitrogen, Sweden) were used for retrograde tracing of commissural interneurons (CINs ...
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Cell Biology 2019Quote: RNF168 si #1: 5’- GGCGAAGAGCGAUGGAGGATT-3’ (Ambion)
-
bioRxiv - Synthetic Biology 2023Quote: ... DynaBead M270 amine (Invitrogen), DynaBead MyOne carboxylic acid (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... siPORT Amine (Invitrogen; #AM4502) was used as the transfection reagent ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 μM 6-JOE-conjugated reverse primer (5’-6-JOE-GATGATCTCCACCTTGCCGT-3’) was extended with 1 pmol of RNA as template using Superscript III (Thermo Fisher) as reverse transcriptase ...
-
bioRxiv - Immunology 2021Quote: ... was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min ...
-
bioRxiv - Neuroscience 2019Quote: ... Neurons were transfected with the CofActor optogenetic system (6 µg plasmid/plate) on day in vitro 3-5 (DIV3-5) using Lipofectamine 2000 (Invitrogen). 48 hours post transfection ...
-
bioRxiv - Biophysics 2023Quote: ... 35 µl of amine-labeled magnetic beads (Thermo Fisher Scientific, M-270 amine, 14307D) was washed with buffer A (0.1 M sodium phosphate ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μL of either 1% biotin dextran amine (BDA-10,000 mW, Thermo Fisher Scientific Cat# D1956 ...
-
bioRxiv - Cancer Biology 2019Quote: ... All TaqMan probes were 5′-6-carboxyfluorescein (FAM) and 3′-6-carboxy-N,N,N′,N′-tetramethylrhodamine (TAMRA) labeled (Applied Biosystems, US) except TATA-binding protein (TBP ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or a 1:1 mixture of two siRNA to CHMP2A (5’-CAGGCCGAGAUCAUGGACAUG-3’ and 5’-GAAGAUGAAGAGGAGAGUGAC-3’) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135; 10 kD BDA Invitrogen D1956; diluted in 0.9% NaCl) were used as retrograde and anterograde tracers ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were mixed with the homobifunctional amine-to-amine crosslinker bis(sulfosuccinimidyl)suberate (BS3, Thermo Scientific) at 20-times molar access and incubated for 30 min at RT ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse 5’-CGA AGG TGT GAC TTC CATG-3’) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). A standard curve was established in parallel using purified SARS-CoV-2 viral RNA.