Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 6 METHOXY 1 3 BENZODIOXOL 5 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293t were replated every 3 days at a split ratio of 1 in 6 following dissociation with Trypsin 0.05% EDTA (Gibco, Life technologies).
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was stained using 4’,6-diamidino-2- phenylindole (DAPI) diluted 1:10000 in PBS containing 3% BSA (Molecular Probes) to illuminate host cell nuclei ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco #25300-054). The HEK293FT cell line tested negative for mycoplasma with the MycoAlert Mycoplasma Detection Kit (Lonza #LT07-318).
-
bioRxiv - Cell Biology 2023Quote: ... KIF18A siRNA used was a 1:1 mixture of the following two Silencer Select Validated siRNAs (5’ to 3’ sequence): GCUGGAUUUCAUAAAGUGGtt (Ambion, AM51334) CGUUAACUGCAGACGUAAAtt (Ambion ...
-
bioRxiv - Cancer Biology 2023Quote: ... KIF18A siRNAs used were a 1:1 mixture of two the following Silencer or Silencer Select Validated siRNAs (5’ to 3’ sequence): GCUGGAUUUCAUAAAGUGGtt (Ambion, AM51334), GCUUGUUCCAGAAUCGAGAtt (Ambion ...
-
bioRxiv - Microbiology 2020Quote: ... The modified nucleotide 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated by PCR using DreamTaq™ DNA Polymerase (Thermo Scientific™) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... С6 and CHO/5-HT2C were maintained in the F12 medium (Invitrogen). In all cases ...
-
bioRxiv - Bioengineering 2024Quote: ... Coupling 5-(and 6)-Carboxytetramethylrhodamine (TAMRA) mixed isomers (Thermo Scientific, Waltham, MA) and Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-PEG2-OH ...
-
bioRxiv - Cell Biology 2022Quote: ... DNP (EM 1:6-1:30, #71-3500, Invitrogen), DPP4 (IF/FACS 1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Immunology 2020Quote: ... Samples were diluted 1:5 in TE buffer and 6% were mixed with TaqMan Universal PCR Master Mix (Applied Biosystems). The sample mix and TaqMan assays were loaded separately into the wells of 96.96 Gene expression Dynamic Arrays (Fluidigm ...
-
bioRxiv - Cell Biology 2021Quote: ... 2X SSC) for 5 min and counter stained with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; Life Technologies). Coverslips were mounted in imaging buffer (3.7 μg/μl glucose oxidase and 1U catalase in equilibration buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5-FU-D131-#6) were labeled by 15 min incubation with 1 μM CFSE (CellTrace CFSE, ThermoFisher Scientific, Ref: C34554). Cells were then resuspended in PBS supplemented with 30% Percoll ...
-
bioRxiv - Immunology 2023Quote: Zebrafish larvae (6 day-post-fertilization) were incubated in embryo medium with 1% DMSO and 5 mM EdU (Invitrogen C10340) for 8 hours at 29°C after the 16 hour Vc infection ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted and quantified from WwoxWT/WT and WwoxP47T/P47T n=6 mice/group (3 males and 3 females) and cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Single cell suspensions were stained with the LiveDead Amine Aqua kit (Thermo Fisher) at 4 degrees C for 30 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... biotinylated dextran amine (D1956, BDA; MW 10,000; 10% in distilled water, Invitrogen, USA) was injected into the sensorimotor cortex at four sites (coordinates ...
-
bioRxiv - Bioengineering 2021Quote: ... aminated surfaces (Corning™ PureCoat™ Amine Culture Dishes, Thermo Fisher Scientific™) were reacted for 2 h with 150 μL/cm2 of a 3 mg/mL suspension of sulfo-succinimidyl-4-(p-maleimidophenyl)-butyrate (S-SMPB ...
-
bioRxiv - Molecular Biology 2022Quote: Tau proteins were fluorescently labeled using amine-reactive DyLight488-NHS ester (Thermo Scientific) following manufacturer instructions ...
-
bioRxiv - Immunology 2022Quote: ... Cells were stained with amine reactive viability dyes to exclude dead cells (Invitrogen) and were blocked with anti-FcR (2.4G2 ...
-
bioRxiv - Neuroscience 2020Quote: ... and ArC amine reactive beads for viability dye (Molecular Probes, Eugene, Oregon, USA). Fluorescent-Minus-One (FMO ...
-
bioRxiv - Immunology 2022Quote: ... Cells were then harvested and stained with a amine-reactive dye (NIR, Invitrogen) and surface antibodies against CD3 ...
-
bioRxiv - Immunology 2019Quote: ... either heat-killed cells or the ArC Amine Reactive Compensation Bead Kit (Invitrogen) were used ...
-
bioRxiv - Immunology 2020Quote: ... samples were incubated with the LIVE/DEAD Aqua amine dye (Invitrogen, Carlsbad, CA), then washed before staining with surface antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... The surface was then blocked with EZ-Link amine-PEG2-biotin (Thermo Scientific). Binding in assay buffer was collected at 20°C and referenced to FC1 ...
-
bioRxiv - Neuroscience 2023Quote: ... approximately 1uL of 25% Alexa 594 conjugated dextran amine tracer (10,000 MW, Invitrogen) in saline was injected 1.8mm deep and 0.5mm lateral from midline into the medulla at a 59° angle (25) ...
-
bioRxiv - Microbiology 2023Quote: ... cells were stained with an amine reactive live/dead dye (efluor506, Thermo Scientific) and an antibody panel (Ly6G-PE ...
-
bioRxiv - Cell Biology 2021Quote: ... HCT8 cells were grown on a 6-well slide (3×105/well, Thermo Scientific) overnight ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293T cells (3×105) were seeded in a 6 well plate (Nunc,Thermo,USA) with DMEM media (Invitrogen,USA ...
-
bioRxiv - Cancer Biology 2019Quote: ... Spheroids pictures were taken after 3 and 6 days using EVOS FL microscope (Thermofisher) and the images were analyzed with ImageJ software ...
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Neuroscience 2019Quote: ... incubation for 3-5’ in 3,3’ diaminobenzidine (DAB, Acros Organics) staining solution (0.025% w/v DAB ...