Labshake search
Citations for Thermo Fisher :
1851 - 1900 of 10000+ citations for Ethyl 5 4 methoxyphenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Cell-free supernatants were diluted to 8 mg/mL and 5 µL of sample was combined with 5 µL of NovexTM Tris-Glycine SDS Sample Buffer (Invitrogen) to load 40 µg per well ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beas-2B cells were cultured at 37°C in a humidified atmosphere of 5% in serum-free 1× defined keratinocyte SFM Gibco) supplemented with 5 µg/mL gentamicin (Gibco). The medium was replaced every 2–3 days and cells were passaged every 4–5 days ...
-
bioRxiv - Microbiology 2022Quote: ... Health and Nutrition (Japan) and cultured at 37 °C with 5% CO2 in DMEM (WAKO) containing 5% fetal bovine serum (Gibco) and penicillin/streptomycin (100 U/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... Digests were allowed to stand for 5 min at room temperature and the supernatants were added to 5 ml of foetal bovine serum (FBS; Gibco) on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Triton X-100 for 5 min and incubated with a blocking buffer containing PBS and 5% normal goat serum (31873; Invitrogen) for 1 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then centrifuged at 400 rcf for 5 minutes and resuspended in cold flow cytometry buffer (calcium free HBSS with 5% fetal bovine serum (FBS, Gibco), 2 mM EDTA ...
-
bioRxiv - Immunology 2021Quote: ... mice were woken up to allow any fecal matter to evacuate and then anesthetized again to introduce 100μL of Cy-5-labelled glucose or Cy-5 secondary goat anti-rat antibody (0.1mM diluted in PBS, ThermoFisher A10525) into the colon via a gavage needle enema ...
-
bioRxiv - Molecular Biology 2021Quote: ... falciparum Dd2 was cultured at 2-5% hematocrit in O+ erythrocytes in Malaria Culture Medium (MCM): RPMI 1640 supplemented with 5 g/L Albumax II (Gibco), 0.12 mM hypoxanthine (1.2 mL 0.1M hypoxanthine in 1 M NaOH) ...
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... The coverslip with the sample was then inverted into the center of an imaging dish containing 150 μL of imaging buffer (Tyrode’s with 5% cosmic calf serum and 5 μg/mL Hoechst 34580 (Invitrogen #H21486), mixed by pipette and vortexed ...
-
bioRxiv - Neuroscience 2020Quote: ... a selected cell terminal was puffed for 5 s with a solution containing 3-5 μM FM1-43 (Molecular Probes) and (in mM) ...
-
bioRxiv - Biochemistry 2021Quote: ... Fractions were loaded onto a cartridge precolumn (5 mm x ID 300 μm, C18 PepMap 100 A, 5 μm particles (ThermoFisher)) ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were injected onto a PepMap100 trap column (0.3 x 5 mm packed with 5 μm C18 resin; Thermo Scientific), and peptides were separated by reversed phase HPLC on a BEH C18 nanocapillary analytical column (75 μm i.d ...
-
bioRxiv - Biochemistry 2020Quote: ... Peptides were trapped and desalted on a C18-column (5 μm Acclaim PepMap100 300 μm x 5 mm, ThermoFisher Scientific) at a flow rate of 30 μl/min with solution A (1% acetonitrile (ACN) ...
-
bioRxiv - Microbiology 2020Quote: ... cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% FBS at 37°C and 5% CO2 along with penicillin and streptomycin antibiotics (Gibco).
-
bioRxiv - Microbiology 2021Quote: ... One milliliter of the culture was incubated for 5 min (at 37°C) with the membrane dye Nile Red (5 µg/ml, Invitrogen), washed once with phosphate buffered saline (PBS) ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were loaded onto the trap column (C18 PepMap100, 5 μm particle size, 300 μm x 5 mm, Thermo Scientific) for 4 min at 18 μl/min ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Cell Biology 2022Quote: ... site-directed mutagenesis was performed as described in Liu & Naismith (32) using primers 5’-ACTACTTCGATGAGATCGCTCTGCTCATGAACCGTCCTCGTGCTG and 5’-AGCGATCTCATCGAAGTAGTCAGACGGTGCGAGTCTTCCAACCTC using Phusion Plus DNA polymerase (#F630S, ThermoFisher). Following confirmation of the RIαB G323D mutation by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... They have been regularly screened for mycoplasma infection using a PCR-based method with the primers Myco1 (5’-GGCGAATGGGTGAGTAACACG) and Myco2 (5’-CGGATAACGCTTGCGACTATG) (Invitrogen) and no cultures have tested positive.
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Developmental Biology 2022Quote: RNA was extracted from an isolated two-kidney pool from each litter of the NP (n = 5) and LP (n = 5) offspring using Trizol reagent (Invitrogen), according to the instructions specified by the manufacturer ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were pelleted one last time at 400 x g for 5 min and resuspended into 5 ml of PBS (GIBCO) supplemented with protease inhibitors (ThermoFischer Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... and then incubated in 5 ml of PBS containing 5 mg EZ-Link Sulfo-NHS-LC-Biotin (Thermo Fisher Scientific) for 30 min at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... epidermidis isolates collected from ocular sources were cultured in 5 ml of brain heart infusion broth (BHI) +5% fetal bovine serum (FBS, Gibco) and shaken at 250 rpm and 37°C for 12–16 h ...
-
Nanoscale molecular architecture controls calcium diffusion and ER replenishment in dendritic spinesbioRxiv - Neuroscience 2021Quote: ... and passed to the plating medium consisting of 5% horse serum and 5% fetal calf serum prepared in minimum essential medium (MEM, Gibco), enriched with 0.6% glucose ...
-
bioRxiv - Microbiology 2021Quote: ... A549 cells were transfected in suspension with 50 pmol per 3×105 cells of scrambled siRNAs (control, 5’UUCUCCGAACGUGUCACGU3’) or siRNAs specific for JIP4 (5’GAGCAUGUCUUUACAGAUCUU3’) using the transfection reagent LipofectamineR 2000 (Invitrogen) according to manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: Full length mouse Unkempt was amplified from cDNA using primers 5’-CACCAGATATCCAATGTCGAAGGGCCCCGGGCCCG-3’ and 5’-GACGACTCTAGATCACGACTGGAGGGCATGGGCCC-3’ and cloned into pENTR/D-TOPO (ThermoFisher) according to the manufacturer’s instructions to create pENTR-Unk ...
-
bioRxiv - Genetics 2022Quote: ... of a PCR amplified region of the rgr-1 locus using OneTaq 2x Master Mix (forward primer DLO1140 5’-TGGAATGGGACTTCCTCTTG-3’ reverse primer DLO1141 5’-TTTCCAAAAGCCAGGACATC-3’) isolated using a GeneJET PCR Purification kit (ThermoFisher). The rgr-1(gk429013 ...
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Control (vehicle: 40 μM HCL, 0.002% BSA [0-5 d]; 0.1% DMSO [5-10 d]; all from Thermo Fisher Scientific) for 0-10 d [=Baseline] ...
-
bioRxiv - Plant Biology 2022Quote: ... 100 mM NaCl, 5 mM MgCl2, 5% glycerol, 0.5% Triton X-100, and 1X Halt protease/phosphatase inhibitor cocktail, Thermo Scientific) using a pre-cooled mortar and pestle ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 5 µl of the bacterial culture placed onto a slide with 5 µl of Prolong (Life technologies; Thermo Fisher Scientific) and covered with a 0.1 % (w/v ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 5 µl of the bacterial culture placed onto a slide with 5 µl of Prolong (Life technologies; Thermo Fisher Scientific) and covered with a 0.1 % (w/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... Peptides were loaded onto a µ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 µm i.d.×5 mm, 5 µm) (ThermoFisher), and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Microbiology 2020Quote: The Q577R gp41 change was introduced into pSHIV-AD8-EO via site-directed mutagenesis using 5’p-TCAAGCAGCTCCGGGCAAGAGTCC-3’ (forward) and 5’p-TGCCCCAGACTGTGAGTTGCAACA (reverse) with Platinum SuperFi PCR mastermix (ThermoFisher) as described in the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA (5 µg) was combined with ERCC Spike-In Standards (5 µl of 1:50 diluted stock solution; Invitrogen) and submitted to the University of Minnesota Genomics Center for library generation and sequencing ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... Each sample was concentrated over an Acclaim PepMap C18 pre-column (5 μm particle size, 0.3 mm ID x 5 mm length, ThermoFisher Scientific) then bound to a 50 cm EasySpray C18 analytical column (2 μm particle size ...