Labshake search
Citations for Thermo Fisher :
1851 - 1900 of 10000+ citations for 3 5 Diacetoxy 2 acetoxymethyl 6 phenethyl tetrahydro pyran 4 yl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Then the F-actin was incubated for 2 h at room temperature with a five-fold molar excess of Alexa-488 NHS ester dye (Life Technologies). F-actin was then pelleted by centrifugation at 450,000 × g for 40 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... The heat-killed bacteria were stained 1:500 with Oregon Green 488-X succinimidyl ester (2 μL of dye from stock in 1 mL of PBS) (Thermo Fisher) fluorescent dye for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... coli MG1655 or BW25113 carrying pBAD18-Kn derived plasmids were diluted 1 in 100 into LB media containing 10 µM OxyBURSTTM Green (2’,7’-dichlorodihydrofluorescein diacetate, succinimidyl ester; Invitrogen #D2935) and incubated at 37°C for 2 h ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA oligonucleotides were obtained as pre-designed siRNAs as follows: MFF-sense strand: 5’-CGCUGACCUGGAACAAGGAdTdT-3’ for exon 2 30 (Ambion, Austin, TX, USA); DLP1-sense strand ...
-
bioRxiv - Neuroscience 2022Quote: ... free floating NAc sections were first washed (3 × 5 min) in 1x PBS containing 2% Triton X-100 (PBST) (Thermo Fisher, Waltham, MA). Sections were then blocked in 5% normal goat serum (NGS ...
-
bioRxiv - Bioengineering 2023Quote: ... pRSV-Rev = 5: 3: 2) were co-transfected into HEK-293T cells at a ratio of 1:1 using lipofectamine 3000 (Invitrogen, USA, Cat: #L3000015). After 48 h ...
-
bioRxiv - Neuroscience 2023Quote: ... An imaging window was constructed from three layers of microscope cover glass (1 x 5 mm, 2 x 3 mm diameter, Fisher Scientific, no. 1) joined with a UV-curable optical glue (NOR-61 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were passaged every 3-4 days using Accutase (Life Technologies) and reseeded at 0.5×104 cells/mL on Geltrex-coated (Life Technologies ...
-
bioRxiv - Genomics 2021Quote: ... followed by 3 mL of methanol (Fisher Scientific; Cat #A454-4), and 600 µL of 3% HCl (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... and the [4– 3] destination vector (pCFJ201) using LR clonase (Invitrogen). Plasmids were inserted into the worm genome as a single copy using the MosSCI technique (Frøkjaer-Jensen et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.05% Trypsin-EDTA (Gibco), and after a few passages ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.25% Trypsin-EDTA (Gibco).
-
bioRxiv - Cell Biology 2024Quote: ... Fast DiI (1,1′-dilinoleyl-3,3,3′,3′-tetramethylindocarbocyanine, 4-chlorobenzenesulphonate, D7756, Invitrogen) to back label parasympathetic preganglionic neurons (PPNs ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were passaged every 3-4 days with TrypLE (12604013, Gibco). Cells were authenticated by STR and tested for mycoplasma annually through Genetica Inc a subdivision of LabCorp.
-
bioRxiv - Biophysics 2023Quote: ... with 3% (v/v) acetonitrile (Thermo Fisher, Cat. No. A996SK-4) and B was 100% acetonitrile ...
-
bioRxiv - Immunology 2022Quote: The production of NO was evaluated using 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-FM DA)(D23844; Invitrogen, Waltham, MA). Following leukocyte isolation ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then washed 4-5 times in PBS for 2 hours and mounted onto glass slides using ProLong Gold Antifade Mountant (Invitrogen; Cat #P36930). Sections were imaged on a Leica SP8 upright confocal laser scanning microscope using a X10/NA 0.45 objective ...
-
bioRxiv - Microbiology 2023Quote: The RBDs of G614, Alpha, Beta, and Omicron (BA.1, BA.2, BA.4/5) variants were ordered as GeneString from GeneArt (Thermo Fisher Scientific). All sequences of the RBD (aa 319-541 in GenBank ...
-
bioRxiv - Physiology 2023Quote: ... and incubated for a period of 1 h in a dark room in 2 ml of extracellular solution containing 5 µM fluo- 4 AM (Thermo Fisher Scientific) or 7 µM Corona Green AM (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 5% Fetal Bovine Serum (FBS), 4°C) and incubated (37°C, 2 minutes) in protease solution (TrypLE express, Thermo Fisher 12604013) supplemented with DNase (100 U/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of cells were collected by centrifugation at 1500 rpm for 5 min at 4°C and stained with anti-SARS-CoV-2 RBD antibody (Invitrogen, PA5-114529). After centrifugation ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 to 4 µL was injected onto an Acclaim PepMap 100 column packed with 2 cm of 5 µm C18 material (Thermo Fisher, 164564) using 0.1% formic acid in water (solvent A) ...
-
bioRxiv - Cell Biology 2024Quote: Cells (2 – 5 x 106) were washed two times with cold PBS and lysed with RIPA buffer at 4°C (Thermo Fisher Scientific) supplemented with protease inhibitor (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubating for one hour at room temperature with 140 µM Alexa Fluor 488 TFP ester or Alexa Fluor 647 TFP ester (Thermo Fisher). After quenching the reaction with excess Tris/HCl the free label was removed by SEC on a Superdex 200 Increase 10/300 column pre-equilibrated with buffer B.
-
bioRxiv - Biophysics 2020Quote: ... Protein A IgG binding buffer (21001) and Alexa Fluor(tm) 647 NHS Ester (Succinimidyl Ester; A20006) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... the different stimulation conditions were subject to barcoding with different concentrations of Pacific Blue NHS ester dye or Pacific Orange succinimidyl ester (both ThermoFisher Scientific). Barcoded conditions were pooled and then subject to further intracellular and surface staining.
-
bioRxiv - Cell Biology 2023Quote: ... followed by staining in 0.5 ml 0.2 M sodium bicarbonate containing 50 mg/ml Alexa Fluor 488 NHS Ester (succinimidyl ester) (Thermo Fisher Scientific #A20100) for 30 min at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... raised dropwise to pH 8.3 using 1.17 M Na2CO3 (pH 11)] were added to the collagen gel before addition of the Alexa Fluor™ 647 NHS Ester (Succinimidyl Ester) dye (A20006, Invitrogen) in 100 μL of PBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Microbiology 2022Quote: ... and L plasmids at a ratio of 4:2:2:2:1 using Lipofectamine 2000 (ThermoFisher Scientific). Cells were transfected in 6 well plates and subsequently transferred to T25 flasks with HEp2 cells until cytopathic effect (CPE ...
-
bioRxiv - Biophysics 2022Quote: ... blotted for 4-6 s at 4°C and 100% humidity using a FEI Vitrobot Mark IV (Thermo Fisher Scientific), and plunge frozen in liquid ethane ...
-
bioRxiv - Biophysics 2022Quote: ... blotted for 4-6 s at 4°C and 100% humidity using a FEI Vitrobot Mark IV (Thermo Fisher Scientific), and plunge frozen in liquid ethane ...
-
bioRxiv - Biophysics 2024Quote: ... and blotted for 4-6 s at 4°C and 100% humidity using the Vitrobot Mark IV system (Thermofisher Scientific), before plunging immediately into liquid ethane for vitrification ...
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells (1 × 107) from passage 5-7 were used for transplantation after staining with carboxyfluorescein succinimidyl ester (CSFE) (Invitrogen, Carlsbad, California, USA) on the day of the transplantation ...
-
bioRxiv - Immunology 2023Quote: ... The debris was washed with PBS (5 min, 13000 x g, RT) and labeled for 1 hour with pHrodo Red succinimidyl ester (Thermo Fisher Scientific) with 2 μL of a 10 mM solution per 10×106 cells ...
-
bioRxiv - Immunology 2023Quote: ... The debris was washed with PBS (5 min, 13 000 x g, RT) and labeled for 1 hour with pHrodo Red succinimidyl ester (Thermo Fisher Scientific) with 2 μL of a 10 mM stock per 10×106 cells ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were dehydrated by sequential submersion in 100% ethanol (2× 5 min) and SafeClear II (2× 5 min, Fisher Scientific) before being mounted in Cytoseal 60 (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 52h after plating 5 µM 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was added for 20 h ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then incubated overnight at 4°C in blocking solution (PBS, 2% normal goat serum, 3% BSA) and primary antibodies (mouse anti-HA, Invitrogen; rabbit anti-GFP, Invitrogen). Cells were then immunolabeled with Alexa-conjugated secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 vein graft slide containing 2-4 cross sections was double stained with the general macrophage marker Mac-3 (rat anti-mouse, Fisher Scientific, B550292, 1:600) and either iNOS (rabbit anti-mouse ...
-
bioRxiv - Immunology 2024Quote: ... differentiated Th2 cells were restimulated with anti-mouse CD3 (4 µg/mL) for 3 hours followed by 2 hours of incubation with monensin (Thermo Fisher Scientific, MA, USA) at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Microbiology 2021Quote: ... 6- diamidino-2-phenylindole dihydrochloride (DAPI; Thermo Fisher D1306; 1:1,000 dilution) for 20 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... in blocking buffer containing 4ʹ,6-diamidino-2-phenylindole (DAPI; 1;1,000, Invitrogen). After staining ...
-
bioRxiv - Cancer Biology 2021Quote: ... Nuclei (DNA) were stained with 6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen). Slides were embedded with Mowiol (0.33 g/ml glycerol (Sigma-Aldrich 15523-1L-R) ...