Labshake search
Citations for Thermo Fisher :
1651 - 1700 of 10000+ citations for 3 5 Diacetoxy 2 acetoxymethyl 6 phenethyl tetrahydro pyran 4 yl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Genetics 2024Quote: ... 5′-UUAAUUUACGCGGUUUUUAUU-3′) using the RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by 4–6 hr incubation with Protein G Dynabeads (Life Technologies). Beads were washed four times with 1 mL of cold radioimmunoprecipitation assay buffer (RIPA ...
-
bioRxiv - Neuroscience 2022Quote: ... The iPSCs were passaged every 4-6 days with Versene solution (Gibco) and split 1:8 to 1:10 each time ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 6 weeks-of-age was fixed in 4% paraformaldehyde (Acros Organics), cryo-preserved using 30% sucrose (Fisher) ...
-
bioRxiv - Biochemistry 2022Quote: ... and blotted for 4 to 6 seconds at 4°C and 100% humidity using the Vitrobot system (ThermoFisher), before plunging immediately into liquid ethane for vitrification ...
-
bioRxiv - Neuroscience 2021Quote: ... Larvae (6 dpf) were transferred to a 3 cm Petri dish (Thermo Scientific) and allowed to acclimatize for 5 min before video recording ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 M-tumours and 6 RE-tumours conserved in RNA-later (ThermoFisher,USA) used for RNA extraction ...
-
bioRxiv - Cell Biology 2021Quote: ... were separated using NuPAGE Bis-Tris gels (4 – 12 %) with 3-(N-morpholino)propanesulfonic acid (MOPS) or 2-(N-morpholino)ethanesulfonic acid (MES) running buffer (Thermo Fisher Scientific) followed by transferring to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2022Quote: N2A cells were transfected as described above with BicD2-KIF tail fusions and MBNL-GFP proteins at a ratio of 2:3 in 4-well chamber slides (Thermo Fisher, 154526). 24 hours after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were washed 4-5 times in PBS for 2 hours then incubated for 3-4 hours with secondary antibody (anti-rabbit Alexa Fluor 568; 1:1000; Invitrogen; Cat #A10042) and NeuroTrace Green Fluorescent Nissl Stain (1:2000 ...
-
bioRxiv - Neuroscience 2024Quote: ... Adult brains were post-fixed for up to 24 hours with 4% paraformaldehyde and cryosectioned after 2-3 days of incubation in 30% sucrose (Thermo Fisher Scientific) in PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... NK cells and target cells were mixed at an effector to target (E/T) ratio of 4:1 (SK-BR-3 cells) or 2:1 (K562 cells) and Sytox Green (Thermo Fisher Scientific) was added at 100 nM ...
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Pathology 2020Quote: ... CHO cells were transfected with 5 ug of human cadherin-6 in pIRES-puro or mouse cadherin-6 in pCDNA3.1 via Lipofectamine 2000 (Invitrogen). After 48hrs ...
-
bioRxiv - Immunology 2021Quote: ... domain of the S-protein were labeled with 4 different fluorophores (Alexa Fluor 647, 488, 594 and 405) using Alexa Fluor NHS Ester kit (Thermo Scientific), were mixed and incubated with S-protein-beads ...
-
bioRxiv - Biophysics 2020Quote: ... This initial PEG treatment was followed by a secondary PEG treatment with 25mM short-chain 333 Da MS(PEG)4 Methyl-PEG-NHS-Ester Reagent (Thermo Scientific). These treatments resulted in a biotin-coated surface on the slide ...
-
bioRxiv - Biophysics 2022Quote: ... the antibody produced in-house from HPC-4 hybridoma, ATCC HB-9892, and labeled with Alexa Fluor 647 NHS Ester, Thermo Fisher), showing superior Wnt display on the hFzd5CRD-1TM cells ...
-
bioRxiv - Biophysics 2023Quote: ... then followed by a secondary PEG treatment with 25 mM short-chain 333 Da MS(PEG)4 Methyl-PEG-NHS-Ester Reagent (Thermo Scientific). A microfluidics chamber was constructed on the slide ...
-
bioRxiv - Biophysics 2024Quote: ... the slides were treated with a short-chain PEG solution (25 mM short-chain 333 Da MS(PEG)4 Methyl-PEG-NHS-Ester Reagent (Thermo Scientific) in 0.1 M sodium bicarbonate ...
-
bioRxiv - Cancer Biology 2024Quote: The PBMCs were plated in 6-well plate (5 × 106 cells in 5 ml RPMI medium, Gibco) overnight at 37℃ in 5% CO2 atmosphere ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The slides were immediately incubated with 0.5 mg/ml biotin 3-sulfo-N-hydroxysuccinimide ester (EZ-link NHS biotin, 20217, Thermo Fisher Scientific, USA) in 0.2 M borate-buffered solution pH 8.6 (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... The chips were immediately incubated with 0.5 mg/ml biotin 3-sulfo-N-hydroxysuccinimide ester (EZ-link NHS biotin, 20217, Thermo Fisher Scientific, USA) in 0.2 M borate-buffered solution pH 8.6 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: 293T-ACE2 and HT1080-ACE2 cells were seeded in 24-well plates and 6-well plates respectively to achieve 70% confluency after 4-6 hours and then transfected with Lipofectamine RNAiMAX (Thermofisher) using the indicated dsiRNAs (IDT ...
-
bioRxiv - Cell Biology 2021Quote: ... Rev: 5’-TCATTGAGACACCATTTGTC-3’ were cloned into pCR™4-TOPO® TA vector using the TOPO-TA cloning kit (Thermo Fisher 450030) and sequence verified.
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Cell Biology 2024Quote: ... or luciferase siRNA (5’ CGUACGCGGAAUACUUCGA 3’, control) were transfected in above RPE1 cells using 4 µl of lipofectamine siRNAmax (Thermo Fisher Scientific, 13778075) and 10 µM of siRNA in 2 ml of cell culture media ...
-
bioRxiv - Bioengineering 2020Quote: ... Alexa Fluor® 594 NHS Ester (Succinimidyl Ester) and Alexa Fluor® 594 Hydrazide were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... The following NHS-ester dyes were used in the present study: DylightTM 405 NHS-ester (Thermo Fisher Scientific, 46400), DylightTM 594 NHS-ester (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... dissociated with Accutase for 3-4 minutes (Fisher Scientific #A1110501), collected via centrifugation ...
-
bioRxiv - Cell Biology 2022Quote: ... or 4 µM TO-PRO-3 Iodide (TOPRO, Thermo Scientific). Acrosomes were visualized using 0.5 µg ml-1 lectin peanut agglutinin (PNA) ...
-
bioRxiv - Microbiology 2024Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine 4-chlorobenzenesulfonate salt (DiD; Invitrogen). IAV sizes were determined via dynamic light scattering (DLS ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Microbiology 2024Quote: ... with the primers pZE21-for (5’-GACGGTATCGATAAGCTTGAT-3’) and pZE21-Pbla-rev (5’-GACTCTTCCTTTTTCAATATTATTGAA-3’) and subsequently dephosphorylated using FastAP (Thermo Fisher Scientific, USA). This approach allowed efficient library preparation and screening for mobilized novel resistance determinants ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-Ethynly-2’-deoxyuridine (EdU; E10415, Thermofisher) was administered to mice via their drinking water at a concentration of 0.2 mg/ml for up to 21 consecutive days (as per 58) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was administered intraperitoneally (500 µg per animal ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2-hydroxy-5-nitrobenzaldehyde (Acros Organics, #416180050 dissolved in ethanol to 120 mM and centrifuged for one minute at 15,000 rpm to remove insoluble material ...
-
bioRxiv - Neuroscience 2020Quote: ... with 5% 2-mercaptoethanol (Thermo Fisher Scientific) was added 3:1 to an aliquot of each sample ...
-
bioRxiv - Developmental Biology 2022Quote: EdU (5-ethynyl-2’-deoxyuridine) powder (Invitrogen) was dissolved in sterile PBS into a working concentration of 2.5 mg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5-ethynyl-2’deoxyuridine (EdU) (Life Technologies) at stated times at a concentration of 10 μM ...
-
bioRxiv - Cell Biology 2020Quote: 5-ethynyl-2’-deoxyuridine (EdU) (Invitrogen, C10418) was dissolved with 2 ml sterile PBS at the concentration of 5 mg/ml (20 mM) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Life Technologies) was injected intraperitoneally (0.3 mg/10 g of mouse weight ...
-
bioRxiv - Neuroscience 2024Quote: ... EdU (5-ethynyl-2’-deoxyuridine, A10044, ThermoFisher) and Doxycycline Hydrochloride (1ug/ml ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5μM 5-ethynyl-2’-deoxyuridine (Thermo Fisher A10044 or component of Click-iT® Alexa Fluor 488 reaction kit ...