Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for 3 5 Diacetoxy 2 acetoxymethyl 6 phenethyl tetrahydro pyran 4 yl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and 6 µl Klenow-Fragment exo-polymerase (Thermo Fisher, 5 U/µl) were added ...
-
bioRxiv - Neuroscience 2024Quote: ... 5-6 dpf zebrafish were paralyzed with alpha-bungarotoxin (Fisher Scientific, B1601) dissolved at the concentration of 0.5 - 1 mg/ml in external solution (in mM ...
-
bioRxiv - Developmental Biology 2024Quote: ... qPCR was performed using FastSYBRGreen 5× MasterMix on a QuantStudio 6 (Invitrogen). Primers were obtained from IDT (Supplementary Table 4) ...
-
bioRxiv - Immunology 2022Quote: Caspase-3 activity was determined using EnzChek™ Caspase-3 Assay Kit #2 (Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... (75 mm i.d. 3 2 cm, Acclaim PepMap100 C18 3 mm, 100 A°, ThermoFisher Scientific) and separated over an EASY-Spray column ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were infected in a BSL-3 lab with the UF-1 strain of SARS-CoV-2 at MOI of 4 in media containing 3% low IgG FBS (Fisher Scientific, Cat. SH30070.03).
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated at 4°C for 3 hours on a rotator before being placed in a DynaMag™-2 magnetic rack (Thermo Scientific, 12321D) and washed twice with TBS+NP40 wash buffer ...
-
bioRxiv - Bioengineering 2020Quote: ... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ...
-
bioRxiv - Neuroscience 2021Quote: ... passaged 1:2-3 when confluent using Tryple (ThermoFisher). When thawing or passaging the iPSCs ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM 2-deoxy-D-glucose (2DG; ACROS Organics), 2 μM PERK inhibitor (PERKi ...
-
bioRxiv - Plant Biology 2022Quote: ... 2–3 μg were treated with Turbo DNase (Ambion). RNA was circularized using T4 RNA ligase and reverse transcription was performed with the Superscript III (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... glass (2 gm, 3 mm bead diameter; Fisher Scientific) and polystyrene (24-well plates ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse-anti-desmocollin-2/3 7G6 (1:250, Invitrogen 32-6200 ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-2 drops of CytoSeal (Thermofisher, 8312-4) were placed on each before mounting a coverslip ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2-4 μg/ml of Blastidin (ThermoFisher Scientific) and 100-400 μg/ml of G418 (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... Puromycin (2-4 μg/ml, Thermo Fisher, A113803) was used for TRIM25-knockdown HEK293T cell selection ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 ng/ml BMP-4 (ThermoFisher Scientific). Then ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Microbiology 2020Quote: Beads were labeled with the following N-hydroxysuccinimide ester (NHS)-activated fluorophores: (i) Alexa Fluor 488 NHS ester (Fisher Scientific) (ii ...
-
bioRxiv - Biophysics 2024Quote: ... Alexa Fluor 532 NHS Ester (Succinimidyl Ester) (Cat# A20101MP) and Ionophore A23187 (Cat# J63020.MA) were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted and quantified from WwoxWT/WT and WwoxP47T/P47T n=6 mice/group (3 males and 3 females) and cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Fluorescently-labelled microtubules were polymerized from 4 mg/ml porcine tubulin (80% unlabelled and 20% Alexa Fluor 647 NHS ester-labelled; Thermo Fisher Scientific) for 2 h at 37 °C in BRB80 (80 mM PIPES ...
-
bioRxiv - Immunology 2023Quote: ... a liver burn injury of approximately 1 mm3 was made on which a droplet of pHrodo Red succinimidyl ester (4 μM; Thermo Fisher Scientific) was administered ...
-
bioRxiv - Immunology 2024Quote: ... 1 mm3 burns were made with a cauterizer and the injury site was then stained with 10 µl of pHrodo Red succinimidyl ester (SE) (4 µM; Thermo Fisher Scientific). The incision was stitched ...
-
bioRxiv - Microbiology 2020Quote: ... The sporozoite-infected culture was maintained for 3 or 5 or 7 days after which the cells were fixed with 4% paraformaldehyde (ThermoFisher Scientific: catalogue number 28906) for 10 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... HCT8 cells were grown on a 6-well slide (3×105/well, Thermo Scientific) overnight ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293T cells (3×105) were seeded in a 6 well plate (Nunc,Thermo,USA) with DMEM media (Invitrogen,USA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Slices were finally incubated for 3-6 minutes with DAPI (1:10 000, Invitrogen) diluted in PBS and mounted on Polysine® Slides stored at 4°C until imaging.
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Immunology 2022Quote: SMGs were fixed for 6-8 hours in 4% paraformaldehyde (PFA; Thermo Scientific) at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... and passaged every 4-6 days with 0.5mM ethylenediaminetetraacetic acid (EDTA, Invitrogen 15575020) in Dulbecco’s Phosphate-Buffered Saline (DPBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 6% Tris-glycine or NuPAGE 4-12% Bis-Tris gels (Invitrogen; cat# NP0321BOX) and transferred to Immobilon-P PVDF membranes (Millipore Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... 4 and 6 hpi RNA was extracted from cells using TRIzol (Invitrogen; 15596026). RNA was isolated and precipitated following the manufacturer’s institutions and 200ng was reverse transcribed into cDNA using the ABI cDNA synthesis kit (Applied Biosystems ...
-
bioRxiv - Bioengineering 2024Quote: ... Spherical beads (4, 6, 8 and 10 μm diameter) were sourced from Invitrogen.
-
bioRxiv - Cell Biology 2020Quote: Carboxyfluorescein succinimidyl ester (CFSE) dye (Thermo Fisher, UK) was added to human skeletal muscle cells in suspension (1ml HBSS ...
-
bioRxiv - Cell Biology 2020Quote: ... Alexa Fluor 647 NHS ester (A20006, ThermoFisher, USA); CF680 NHS ester (92139 ...
-
bioRxiv - Cell Biology 2020Quote: ... Alexa Fluor 546 NHS ester (A20002, ThermoFisher, USA); DyLight 405 NHS ester (A46400 ...
-
bioRxiv - Bioengineering 2021Quote: ... we used carboxyfluorescein diacetate succinimidyl ester (CFSE, ThermoFisher) to label the cells according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... with Alexa Fluor 488 succinimidyl ester (Thermo Fisher) dissolved in the reaction mixture of PEG-SVA and RGDS ...
-
bioRxiv - Systems Biology 2021Quote: ... or Alexa Fluor 488-NHS ester (Invitrogen A20000) in-house as described previously(32).
-
bioRxiv - Cell Biology 2022Quote: ... ethyl ester (TMRE, final concentration 20nM, Life Technologies) in the relevant medium for 10 min and analyzed by confocal microscopy (Takashima et al. ...
-
bioRxiv - Immunology 2022Quote: ... and the succinimidyl ester of AlexaFluor 488 (ThermoFisher) were used per manufacturer’s protocol for microscopy ...
-
bioRxiv - Biophysics 2022Quote: ... or Alexa Fluor-488 NHS Ester (Molecular Probes), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Fluorescently labeled (Alexa Fluor 488 NHS ester; Invitrogen) fibrinogen (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... Reactive esters were used for labeling (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... and Pacific Orange-NHS-Ester (PO, Molecular Probes) dissolved in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Molecular Biology 2021Quote: ... AF488 (A37570, Alexa Fluor 488 TFP ester, Invitrogen) was diluted to 0.5 mg/mL using dimethyl sulfoxide (D12345 ...