Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for mu p75 SAP Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... PCR products together with a non-template control were checked on 1% agarose gels and then cleaned with the Qiagen PCR Purification Kit and sequenced using an ABI 3130xL sequencer and the BigDye Cycle Sequencing Kit (Applied Biosystems). In total we found four mtDNA haplotypes ...
-
bioRxiv - Cancer Biology 2019Quote: ... total RNA was isolated using E.Z.N.A.® MicroElute Total RNA Kit (Omega Bio-tekkit) and transcribed into complementary DNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time PCR reactions were carried out using 1x GoTaq™ qPCR Master Mix (Promega ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... purified fosmid DNA was first fragmented into approximately 1.5 kb fragments using a Nebulizer kit supplied in the TOPO shotgun Subcloning kit (Invitrogen, Carlsbad, CA), and then sub-cloned into pCR4Blunt-TOPO vectors ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted later on from each hemi-embryo using PicoPure RNA isolation kit (PicoPure RNA isolation kit, Applied Biosystems, France), which included a DNAse treatment ...
-
bioRxiv - Biophysics 2021Quote: ... Pellets were resuspended in PBS and semEV concentrations were estimated by BSA protein kit (Thermo Fisher, Pierce BCA Protein Assay Kit) and adjusted to 2mg/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... Library quality and quantification was assessed on the Agilent Fragment Analyzer using a High Sensitivity NGS Kit (DNF-474) and a Qubit 4 RNA BR kit (Thermo Fisher). Samples were then normalized to 4nM and pooled in equimolar amounts ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were sequenced using BigDye Terminator v3.1 cycle sequencing kit and cleaned with BigDye XTerminator Purification kit (Applied Biosystems, USA). Products were analysed on a 3130xl Genetic Analyzer (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: Subcellular protein fractionation and isolation of chromatin fractions was performed using the Subcellular Protein Fractionation Kit for Cultured Cells kit from Thermo Fisher, following the instructions of the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: Our metabolic click-labelling was based on the Click-iT HPG Alexa Fluor protein Synthesis Assay Kit (Click-iT HPG Alexa Fluor Protein Synthesis Assay Kit, ThermoFisher C10428) strategy ...
-
Hypoxia-mediated suppression of pyruvate carboxylase drives tumor microenvironment immunosuppressionbioRxiv - Cancer Biology 2022Quote: ... RNA was isolated (EZNA HP Total RNA kit) and cDNA was synthesized (Thermo Scientific, Verso cDNA Synthesis Kit #AB-1453/B).
-
bioRxiv - Microbiology 2021Quote: ... were performed with the Express one step RT-qPCR Universal kit (EXPRESS One-Step Superscript™ qRT-PCR Kit, universal Invitrogen) using 3.5µL of RNA and 6.5µL of RT qPCR mix and standard fast cycling parameters ...
-
bioRxiv - Immunology 2020Quote: ... RNA was purified using the Zymo RNA clean & concentrator-25 kit and quantitated using the Qubit RNA BR assay kit (Thermo Fisher). A beta release of the Collibri 3’ mRNA Library Prep Kit (Invitrogen ...
-
bioRxiv - Physiology 2022Quote: ... 20 mg of pulverized tissue were dissolved in the assay buffer from the kit as suggested by the manufacturer and normalized to protein content by Pierce™ BCA Protein Assay Kit (ThermoFisher). 250 μg of protein was used for each reaction ...
-
bioRxiv - Genomics 2019Quote: Total RNA was isolated from MOLM13 cells using the RNeasy midi kit (Quiagen) and polyA+ RNA was purified from 30μg total RNA using the Dynabeads mRNA Purification Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: Ten micrograms from each total RNA sample was treated with the MICROBExpress Bacterial mRNA Enrichment kit and RiboMinus™ Transcriptome Isolation Kit (Bacteria) (Invitrogen). Bacterial mRNAs were chemically fragmented to the size range of 200-250 bp using 1 × fragmentation solution for 2.5 min at 94°C ...
-
bioRxiv - Cell Biology 2019Quote: ... ELISAs were performed using FBLN5 (Fibulin-5) Human ELISA Kit from Fine Test (EH0772) and Thrombospondin 1 (TSP1) Human ELISA Kit from Invitrogen (BMS2100), following the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA libraries were amplified and barcoded using Ion Total RNA-seq kit v2 and Ion Xpress RNA-seq Barcode Adapters 1-16 Kit (Thermofisher Scientific). The amplicons were quantified using Agilent High Sensitivity DNA kit before the samples were pooled in sets of fifteen ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA was extracted from iPSC cells using the NucleoSpin RNA kit (Machery-Nagel) and cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies). qRT-PCR was performed on all the TTLL/CCP fragments generated from primers designed in supplementary figure 5 and the housekeeping control GAPDH (GAPDHFOR 5′ − GAAGGTGAAGGTCGGAGT − 3′ and GAPDHREV 5′GAAGATGGTGATGGGATTTC − 3′).
-
bioRxiv - Physiology 2020Quote: ... HFF was processed using a exosome isolation kit (Total Exosome Isolation Kit, Invitrogen, #4484450 and Total Exosome Isolation Reagent, Invitrogen #4484453) per the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2019Quote: ... and cloned using isothermal assembly.43 Relevant plasmid sequences are included in the Supplementary Table 2 All plasmids were purified for cell-free expression using Qiagen Plasmid Midiprep Kit (Cat. 12145) and quantified by Qubit dsDNA BR Assay Kit (Invitrogen #Q32853).
-
bioRxiv - Genetics 2021Quote: ... We isolated polyA+ mRNA using the Qiagen Oligotex mRNA kit for the 1000 x 1000 ExP dataset (note this kit has been discontinued, we now use the Poly(A)Purist MAG kit from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: The amino-biotinylation of fluoxetine and RR-HNK was performed using a commercial kit (EZ-Link NHS-PEG4 Biotinylation Kit, #21455, Thermo Scientific) and the reaction monitored by mass spectrometry (Tikka et al. ...
-
bioRxiv - Immunology 2022Quote: ... or Single Cell RNA purification Kit (Norgen 51800) and reverse transcription was performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) by following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was used as a template to create labeled cDNA using MessageAmpTM Premier RNA Amplification Kit and MessageAmpTM III RNA Amplification Kit (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was isolated from cells by using a Qiagen RNeasy kit and then reverse transcribed to generate cDNA with the High Capacity cDNA kit (Applied Biosystems). Quantitative PCR was performed by using SYBR green (Quanta Biosciences ...
-
bioRxiv - Systems Biology 2020Quote: ... Extracted DNA and RNA in each sample were quantified using dsDNA HS assay kit and RNA HS assay kit on the Qubit 2.0 Fluorimeter (Life Technologies, NY), respectively.
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV2 RNA was quantified using (LabGun™ COVID-19 RT-PCR Kit) following the manufacturer’s protocol or following WHO guidelines using SuperScript™ III Platinum™ One-Step qRT-PCR Kit (ThermoFisher) and Taqman probes against CoV-2 E ...
-
bioRxiv - Immunology 2021Quote: ... mouse uncoated ELISA kit (Catalog no. 88-50400-22) and IgM mouse uncoated ELISA kit (Catalog no. 88-50470-22) were from Thermo Fisher Scientific (Winnipeg ...
-
bioRxiv - Cell Biology 2021Quote: ... Induced pluripotent stem cells were derived from human fibroblasts using Sendai virus-based reprogramming kit (CytoTune-iPS Sendai Reprogramming Kit; cat #. A13780-01; Thermo Fisher), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The extracts were enriched and processed for library preparation using kit Ion Total RNA-Seq Kit v2.0 (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions with a minor modification ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... interleukin-6 and -8 (IL-6 and IL-8) human Instant Elisa™ kits and matrix metalloproteinase-1 (MMP-1) human Elisa kit from ThermoFisher Scientific.
-
bioRxiv - Bioengineering 2022Quote: ... cDNA was synthesized from 10 ng of the total RNA with a commercially available kit (High-Capacity cDNA Reverse Transcription Kit, Thermo Fisher). Quantitative PCR (qPCR ...
-
bioRxiv - Bioengineering 2022Quote: Cell proliferation in T-SLICE zones was analyzed using an EdU (5-ethynyl-2’-deoxyuridine) Cell Proliferation Kit (Click-iT− EdU Cell Proliferation Kit for Imaging, Alexa Fluor™ 488 dye: Invitrogen). Cell culture media was supplemented throughout with 10 uM EdU ...
-
bioRxiv - Cancer Biology 2022Quote: ... TNF alpha mouse high sensitivity ELISA kit and IL-6 mouse high sensitivity ELISA kit were from Invitrogen (Thermo Fisher Scientific), mouse CCL2/JE/MCP-1 quantikine ELISA kit ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were purified using the Qiagen miRNeasy kit and resulting concentrations were measured using Qubit RNA Broad Range Assay Kit (Thermo Fisher) and the Qubit Fluorometer (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were sequenced using BigDye Terminator v3.1 cycle sequencing kit and cleaned with BigDye XTerminator purification kit (Applied Biosystems, USA). Products were analyzed on a 3130xl Genetic Analyzer (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR products were first purified using the QiaQuick PCR purification kit and used as a template for in vitro transcription of the sgRNA with the MEGAshort script T7 kit (ThermoFisher, AM1354). Following in vitro transcription ...
-
bioRxiv - Plant Biology 2023Quote: ... ONT sequencing was done using the MinION Mk1B, where the Ligation Sequencing Kit 1D (SQK-LSK108, ONT) and Rapid Sequencing Kit (SQK-RAD0004, Life Technologies) were used for library preparation and tested on a FLO-MIN106 flow cell ...
-
bioRxiv - Neuroscience 2022Quote: ... High-Capacity cDNA Reverse Transcription Kit and Mir-X™ miRNA First Strand Synthesis Kit were purchased from Applied Biosystems (USA) and Takara (China ...
-
bioRxiv - Physiology 2022Quote: ... Cells were further processed with single cell RNA seq Kit (10X Genomics, Pleasanton, CA) or with the Arcturus PicoPure RNA Isolation Kit (Applied Biosystems) for RNA extraction.
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were tested for average fragment length using Agilent High Sensitivity DNA Kit (5067-4626) and concentration was tested using Qubit™ dsDNA HS kit (#Q32851, Invitrogen). DNA was stored at −20°C until used for sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... Bicinchoninic acid (BCA) assay kit for protein quantification and MitoProbe JC-1 Assay kit for flow cytometry were procured from Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... 5’-capped cRNA was prepared from the pGEMHE vector containing cDNA of opsin (see above) using an in vitro transcription kit (mMESSAGE mMACHINE Kit, Life Technologies). Typically ...
-
bioRxiv - Cell Biology 2023Quote: RNAs extracted by either Trizol or RNeasy Plus Micro Kit were reverse transcribed to cDNAs using High-Capacity cDNA Reverse Transcription Kit (4368814; Applied Biosystems), and quantitative PCR was performed using DyNAmo Flash SYBR Green qPCR Kit (F415S ...
-
bioRxiv - Microbiology 2023Quote: ... equal amounts of RNA from each sample were used for cDNA synthesis with the kit Revertaid First Strand cDNA synthesis Kit (Thermo Scientific). The obtained cDNA was diluted to 2-4 ng/µl for subsequent qPCR with the Sybr Green (Applied Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: ... 180 μg of mitochondrial proteins were subjected to a click reaction using a commercial kit (Click-iT Cell Reaction Buffer Kit; Thermo Fisher), with 40 μM Tetramethylrhodamine (TAMRA)-azide (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... These constructs were then used for in vitro translation using a HeLa cell lysate-based Kit (1-Step Human Coupled IVT Kit—DNA, 88881, Life Technologies). The in vitro-translated proteins were then purified using His Pur cobalt spin columns (Thermo Scientific) ...
-
bioRxiv - Systems Biology 2023Quote: ... Libraries were purified using NucleoMag beads supplied in the library preparation kit and subsequently quantified using the Qubit 4 Fluorometer and the Qubit dsDNA HS assay kit (Invitrogen, #Q32854). The size distribution was checked using the TapeStation 4200 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total mRNA was isolated with a PureLink RNA Mini Kit (life technologies) and cDNA synthesis was performed with a SuperScript III kit (Life Technologies), as per the manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library preparation for RNA sequencing was performed using the Ion Total RNA-Seq V2 kit and Ion Xpress RNA-Seq Barcode kit (Thermo Fisher). Library quality control was performed using the Ion Library Taqan Quantitation kit (Thermo Fisher) ...