Labshake search
Citations for Thermo Fisher :
1651 - 1700 of 10000+ citations for mu p75 SAP Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: The LIVE/DEAD Viability/Cytotoxicity Kit (Invitrogen: L3224) was used following the manufacturer’s instructions to evaluate cell survival ...
-
bioRxiv - Plant Biology 2023Quote: ... using the DynabeadsTM mRNA DIRECTTM Micro Kit (Invitrogen), according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2024Quote: ... and Qubit dsDNA High Sensitivity kit (Q32851, Invitrogen). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... using the Maxima SYBR Green kit (Thermo Scientific). Oligonucleotides used for qRT-PCR are listed in Supplementary Table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the Gateway LR Clonase II kit (Invitrogen). Integrity and orientation of inserts was checked further by Sanger sequencing before using plasmids to generate transgenic Drosophila.
-
bioRxiv - Microbiology 2023Quote: The Live/dead BacLight Bacterial Viability Kit (Invitrogen) was used according to manufacturer’s instructions with stationary phase R ...
-
bioRxiv - Microbiology 2023Quote: ... and the Qubit dsDNA HS Assay Kit (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: Northern blotting was performed using NorthernMax kit (Invitrogen) with adaptations as described ...
-
bioRxiv - Genomics 2023Quote: ... and the Qubit dsDNA HS kit (Invitrogen #Q32854). Libraries were sequenced on an Illumina NextSeq 500 at a target depth of 4-8 million reads ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... The Qubit RNA HS Assay Kit (Invitrogen #Q32855) was used to quantify RNA and the High Capacity cDNA Reverse Transcription Kit (Invitrogen #4368813 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Qubit dsDNA BR Assay-Kit (Thermo Fisher Scientific) was employed to quantify DNA concentrations obtained from each isolate accurately ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the mMESSAGE mMACHINE T7 Kit (Ambion, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... or the PureLink RNA Mini Kit (ThermoFisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Broad Range Assay Kits (Thermo Fisher Scientific, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... or Taqman MicroRNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... using a Qiagen miniprep kit (Thermo Fisher Scientific). Both the δ insert and pET28 plasmid were digested with the restriction enzymes XbaI and BamHI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the Neon 10uL Transfection kit (MPK1096 Invitrogen) with the following conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... the Pierce BCA Protein Assay kit (Thermo Scientific) was used.
-
bioRxiv - Biochemistry 2023Quote: ... and purified with RNA purification kit (Ambion, 12183025). The concentration and purity of RNA was determined using a NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... using SYBR Green Master kit (Thermo Fisher Scientific) supplemented with 0.5 µM of specific primers (sequences are detailed in supplemental Tables S1 and S2) ...
-
bioRxiv - Cancer Biology 2023Quote: ... A cDNA synthesis kit (Applied Biosystems, Waltham, MA) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... plasmid 46757)74 using mMESSAGE mMACHINE transcription kit (Thermofisher Scientific). Constant oligomer (5’AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATT TTAACTTGCTATTTCT AGCTCTAAAAC-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... or the Superscript IV transcription kit (ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The BCA Protein Assay Kit (Thermo Fisher, USA). Roswell Park Memorial Institute (RPMI ...
-
bioRxiv - Cell Biology 2023Quote: ... Pierce BCA Protein Assay kit from Thermo Scientific and TAG kit from Biosino Bio-technology and Science Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... Qubit ssDNA Assay Kit (Thermo Fisher Scientific, Q10212) was used to quantify the constructed libraries ...
-
bioRxiv - Neuroscience 2023Quote: ... or CytoTune iPS 2.0 Sendai Reprogramming Kit (ThermoFisher) (line TSP23-9) ...
-
bioRxiv - Cell Biology 2023Quote: ... The Qubit RNA High Sensitivity Assay Kit (Invitrogen) was used to quantify RNA concentration ...
-
bioRxiv - Neuroscience 2023Quote: ... we employed an ATP Determination kit (Invitrogen, A22066). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... Alexa Fluor 488 tyramide SuperBoost kit (ThermoFisher, B40922) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse IL1β ELISA Kit (Thermo Fisher Scientific, BMS6002), Mouse IL10 ELISA Kit (R&D Systems ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... using Qubit™ dsDNA HS Assay Kit (Invitrogen). Samples were then treated with P1 nuclease (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... The Click-iT EdU kit (ThermoFisher, no. C10340) AF+647 was used according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and Qubit RNA HS Assay Kit (Invitrogen, #Q32855), and Agilent RNA TapeStation reagents (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: ... using Collibri™ Library Quantification Kit (ThermoFisher # A38524100). Final pooling was based on the concentrations as measured by the Collibri quantification method and samples were sequenced on an Illumina MiSeq Sequencer using a MiSeq Reagent Nano Kit with 30% PhiX spike-in control and 400 nt forward read with output of both indexes.
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized with the SuperScriptII kit (Invitrogen) and used as a template for qPCR assays with the MESA BLUE kit (Takyon) ...
-
bioRxiv - Plant Biology 2023Quote: ... purified with PureLink HiPure Plasmid Midiprep Kit (Thermofisher). After transfections ...
-
bioRxiv - Biochemistry 2023Quote: ... EZQ® Protein Quantitation Kit (Invitrogen™, R33200).
-
bioRxiv - Genetics 2023Quote: ... using the miRVana miRNA Isolation Kit (Invitrogen, #AM1561) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and the RNA Broad Range assay kit (ThermoFisher). SARS-CoV-2 Nucleocapsid-1 (N1 ...
-
bioRxiv - Neuroscience 2024Quote: ... using the Amplex Red Hydrogen Peroxide Kit (Invitrogen). Flies (10/genotype/replicate ...
-
bioRxiv - Physiology 2024Quote: ... BCA Protein Assay Kit (Thermo Fisher; Waltham, MA) was utilized for protein quantification ...
-
bioRxiv - Immunology 2024Quote: ... cells using the Expi293 Expression System Kit (Gibco). The heavy immunoglobulin variable region sequences were inserted into the human heavy chain mu constant region secretory sequence (Genbank accession number BC073758.1 ...
-
bioRxiv - Genomics 2023Quote: ... DNA concentration measured with Qubit HS kit (Invitrogen) and DNA size was validated by Femto Pulse System (Agilent).
-
bioRxiv - Microbiology 2023Quote: ... the TURBO DNase (TURBO DNA-free kit, Invitrogen) was used according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Colloidal Blue Staining Kit (Invitrogen, Carlsbad, CA, LC6025)
-
bioRxiv - Biochemistry 2023Quote: ... and a TOPO cloning kit (Thermo Fisher Scientific) as previously described (16 ...
-
bioRxiv - Microbiology 2023Quote: ... A Museek DNA fragment library preparation kit (ThermoFisher) was used to tagment genomic DNA and was then purified with AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Systems Biology 2023Quote: ... using a DNA HS assay kit (Thermofisher #Q32851) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and quantified with dsDNA HS assay kit (Invitrogen) on a Qubit 3 fluorometer (Invitrogen) ...