Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 7266 citations for Human Coronavirus NL63 Nuceloprotein E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... ClpL NTD mutants A-E were generated utilizing synthetic DNA as template (Invitrogen™) and restriction cloning ...
-
bioRxiv - Microbiology 2023Quote: ... DNA bands were visualized using E-Gel™ EX Agarose Gels (2%, Invitrogen #G401002) under UV light.
-
bioRxiv - Microbiology 2024Quote: ... followed by incubation with an anti-E-cadherin mouse mAb (4A2C7, Life Technologies, France) directed against the cytoplasmic domain of E-cad and a monoclonal anti-Occludin mouse mAb (331500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 μg/mL of E-cadherin functional blocking antibody (HECD-1, #13-1700, ThermoFisher) was added to each well ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Cell Biology 2019Quote: ... Escherichia coli strains were grown at 37°C in NZCYM medium (Fisher Scientific) supplemented with ampicillin (100 µg/ml).
-
bioRxiv - Immunology 2021Quote: ... coli bacteria were preloaded with 10 μM CFSE fluorescent dye (Molecular Probes, Invitrogen) in PBS for 30 min at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... coli bacteria were preloaded with 10 μM CFSE fluorescent dye (Molecular Probes, Invitrogen) in PBS for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli BW25113 topA mutants night culture using GeneJET Genomic DNA purification kit (ThermoFisher) according to the manufacturer protocol ...
-
bioRxiv - Microbiology 2019Quote: ... All proteins were expressed in Escherichia coli one-shoot BL21star (DE3) cells (Invitrogen), as previously described (Selyutina et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... Coli competent cells and amplified using the GeneJET Plasmid Maxiprep Kit (Thermo Scientific). Diagnostic PCR with the MIGR1 primers set ...
-
bioRxiv - Microbiology 2020Quote: ... coli-derived recombinant BAG1) and secondary goat anti-rabbit 594 (1:1000, Invitrogen).
-
bioRxiv - Microbiology 2020Quote: ... coli strains were grown aerobically at 37°C in lysogeny broth (LB, Affymetrix) supplemented with 15 μg/mL chloramphenicol or 50 μg/mL kanamycin when required ...
-
bioRxiv - Neuroscience 2020Quote: ... coli were spread onto the plate using 3 mm glass beads (Fisher Scientific).
-
bioRxiv - Cell Biology 2022Quote: ... coli DH5α and extracted by using PureLink™ HiPure Plasmid Miniprep Kit (Invitrogen). Antibodies were expressed using the ExpiCHO™ expression system (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2022Quote: ... coli BL21 (DE3) RIL cells according to the manufacturer’s protocol (Invitrogen, Karlsruhe, Germany) and isolated and affinity-purified using amylose resin according to the manufacturer’s protocol (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... the recombinant 3CLpros were expressed in Escherichia coli BL21 cells (Invitrogen, Carlsbad, CA) grown in Luria Bertani broth induced with 1mM isopropyl ß-D-thiogalactopyranoside ...