Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and then incubated in 5 ml of PBS containing 5 mg EZ-Link Sulfo-NHS-LC-Biotin (Thermo Fisher Scientific) for 30 min at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... epidermidis isolates collected from ocular sources were cultured in 5 ml of brain heart infusion broth (BHI) +5% fetal bovine serum (FBS, Gibco) and shaken at 250 rpm and 37°C for 12–16 h ...
-
Nanoscale molecular architecture controls calcium diffusion and ER replenishment in dendritic spinesbioRxiv - Neuroscience 2021Quote: ... and passed to the plating medium consisting of 5% horse serum and 5% fetal calf serum prepared in minimum essential medium (MEM, Gibco), enriched with 0.6% glucose ...
-
bioRxiv - Microbiology 2021Quote: ... A549 cells were transfected in suspension with 50 pmol per 3×105 cells of scrambled siRNAs (control, 5’UUCUCCGAACGUGUCACGU3’) or siRNAs specific for JIP4 (5’GAGCAUGUCUUUACAGAUCUU3’) using the transfection reagent LipofectamineR 2000 (Invitrogen) according to manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: Full length mouse Unkempt was amplified from cDNA using primers 5’-CACCAGATATCCAATGTCGAAGGGCCCCGGGCCCG-3’ and 5’-GACGACTCTAGATCACGACTGGAGGGCATGGGCCC-3’ and cloned into pENTR/D-TOPO (ThermoFisher) according to the manufacturer’s instructions to create pENTR-Unk ...
-
bioRxiv - Genetics 2022Quote: ... of a PCR amplified region of the rgr-1 locus using OneTaq 2x Master Mix (forward primer DLO1140 5’-TGGAATGGGACTTCCTCTTG-3’ reverse primer DLO1141 5’-TTTCCAAAAGCCAGGACATC-3’) isolated using a GeneJET PCR Purification kit (ThermoFisher). The rgr-1(gk429013 ...
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Control (vehicle: 40 μM HCL, 0.002% BSA [0-5 d]; 0.1% DMSO [5-10 d]; all from Thermo Fisher Scientific) for 0-10 d [=Baseline] ...
-
bioRxiv - Plant Biology 2022Quote: ... 100 mM NaCl, 5 mM MgCl2, 5% glycerol, 0.5% Triton X-100, and 1X Halt protease/phosphatase inhibitor cocktail, Thermo Scientific) using a pre-cooled mortar and pestle ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 5 µl of the bacterial culture placed onto a slide with 5 µl of Prolong (Life technologies; Thermo Fisher Scientific) and covered with a 0.1 % (w/v ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 5 µl of the bacterial culture placed onto a slide with 5 µl of Prolong (Life technologies; Thermo Fisher Scientific) and covered with a 0.1 % (w/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... Peptides were loaded onto a µ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 µm i.d.×5 mm, 5 µm) (ThermoFisher), and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Microbiology 2020Quote: The Q577R gp41 change was introduced into pSHIV-AD8-EO via site-directed mutagenesis using 5’p-TCAAGCAGCTCCGGGCAAGAGTCC-3’ (forward) and 5’p-TGCCCCAGACTGTGAGTTGCAACA (reverse) with Platinum SuperFi PCR mastermix (ThermoFisher) as described in the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA (5 µg) was combined with ERCC Spike-In Standards (5 µl of 1:50 diluted stock solution; Invitrogen) and submitted to the University of Minnesota Genomics Center for library generation and sequencing ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... Each sample was concentrated over an Acclaim PepMap C18 pre-column (5 μm particle size, 0.3 mm ID x 5 mm length, ThermoFisher Scientific) then bound to a 50 cm EasySpray C18 analytical column (2 μm particle size ...
-
bioRxiv - Immunology 2020Quote: Crosslinked samples were reconstituted in 5% FA/5% acetonitrile (ACN) and analysed in the Orbitrap Fusion Lumos Mass Spectrometer (ThermoFisher) coupled to an EASY-nLC 1200 (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... After the fourth EDTA incubation the pieces were cut into 2 mm2 pieces and placed in 5 mL digestion solution containing 5% fetal bovine serum (Gibco), 10 mM HEPES (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: To prepare the probe for hybridisation approximately 200-600ng of labelled probe DNA was ethanol precipitated with the 5 µg of sheared salmon sperm DNA and 5 µg of mouse or human Cot1 DNA (both from Invitrogen) and resuspended in hybridisation buffer (50% formamide ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Cancer Biology 2022Quote: ... minced skin was incubated at 37°C for 3 – 5 hours in 5 ml of DMEM high glucose (#41965-039; Gibco) supplemented with 10 mg ml-1 collagenase (#C9891 ...
-
bioRxiv - Developmental Biology 2022Quote: ... at 38.5°C overnight in sealed sterile vials containing 5% CO2 in air-equilibrated Medium 199 with Earle’s salts (Thermo Fisher), supplemented with 10% fetal bovine serum (Hyclone) ...
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples (5 μl) were injected on a C18 PepMap trap column (5 μm, 100 μm I.D. x 2 cm, Thermo Scientific) at 10 μl/min ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples (5 μl) were injected on a C18 PepMap trap column (5 μm, 100 μm I.D. x 2 cm, Thermo Scientific) at 20 μl/min ...
-
bioRxiv - Neuroscience 2023Quote: ... The blood was quickly collected with a syringe and transferred in 0.75 mL tubes containing 5 μL EDTA and 5 μL Halt protease and phosphatase inhibitor cocktail (100x, Thermo Scientific). Blood samples were centrifuged for 10 min at 2000 x g at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... to a final concentration of 5% and fetal bovine serum to a final concentration of 5% and 1% penicillin-streptomycin (Invitrogen) or Clear X9-Stem™ at 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... A549 cells were seeded in 96-well microtiter plates at a concentration of 5−104 cells per well for 24 h (37°C, 5% CO2) in DMEM (Gibco) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Molecular Biology 2024Quote: ... boiled at 95°C for 5 mins and spun at 21 300 rcf for 5 mins prior to loading in NuPAGE Tris-Acetate gels (Invitrogen). Gels were run at 150 V for 1 h and transferred onto 0.2 µm PVDF membranes using the High MW setting on the Trans-Blot Turbo (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... about 5 million K562 cells were transfected with 5 μg luciferase reporter plasmid using Neon™ NxT Electroporation System (Invitrogen). Cells were fixed after 24 hours and ChIP performed as described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were loaded onto the trap column (C18 PepMap100, 5 μm particle size, 300 μm x 5 mm, Thermo Scientific) for 4 min at 18 μL/min ...
-
bioRxiv - Microbiology 2024Quote: ... GP2-293 cells were seeded at 5×106 on 10-cm plates and transfected 24 h later with 5 µg of LUJV-flag/LUJV-flag-mut and 5 µg Luciferase using Lipofectamine 2000 (Invitrogen). Cells’ media were replaced 5 h later to full medium ...
-
bioRxiv - Genetics 2023Quote: RNA was extracted from the stock of D388-WT and the sequence of the 5′ UTR was determined using a 5′ RACE system for rapid amplification of cDNA ends (Invitrogen) using IBV-specific oligonucleotides 5′-TGTCTGCTCACTAAAC-3′ for the reverse transcription step and 5′-AGAACGTAGCCCAACGC-3′ for the amplification of dC-tailed cDNA step ...
-
bioRxiv - Cell Biology 2023Quote: Whole proteome and phosphopeptide samples were dissolved in 2% [v/v] ACN 0.1% [v/v] TFA and injected onto a C18 PepMap100-trapping column (0.3 x 5 mm, 5 μm, Thermo Scientific) connected to an in-house packed C18 analytical column (75 μm x 300 mm ...
-
bioRxiv - Cell Biology 2023Quote: ... An Acclaim PepMap C18 trap-column (5 µm particle size, 0.3 mm ID x 5 mm length; ThermoFisher Scientific, #160454) was used to concentrate the sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were seeded in 6-well plates (2.25 x 10^5 cells per well) supplemented with 5 nM siRNA premixed with Opti-MEM Reduced Serum Medium (Gibco) and Lipofectamine RNAi Max Transfection Reagent (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... Peptides were trapped on a PepMap C18 trap column (300 µm x 5 mm, 5 µm particle size, Thermo Fisher) and separated on a 50 cm Easy-Spray column (ES803 ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Bioengineering 2023Quote: ... the gels were washed with wash buffer three times for 5 min followed by permeabilization and blocking in 5% goat serum (Gibco), 1% BSA ...