Labshake search
Citations for Thermo Fisher :
1651 - 1700 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 5-etinil-2’-desoxiuridina (EdU; A10044, ThermoFisher) is a small thymidine analogue that can be detected using click chemistry ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5% Horse Serum (Invitrogen Cat# 16050-122) and 1% Penicillin Streptomycin Glutamine (PSG ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 5% horse serum (ThermoFisher, #16050122), 100 U/ml penicillin-streptomycin ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% donor horse serum (26050088, Gibco), 20 ng/mL EGF (PHG0311 ...
-
bioRxiv - Cell Biology 2024Quote: ... and run on QuantStudio 5 (Applied Biosystems). The analysis was performed using the 2-ΔΔCT method (56) ...
-
bioRxiv - Bioengineering 2024Quote: ... and 5 mL GlutaMAX (35050-079, Gibco). Stage 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% FBS (Life Technologies 10082147; Thermo Fisher), 50 μg/ml streptomycin ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% FBS (Life Technologies 10082147; Thermo Fisher), 50 μg/ml streptomycin ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5% penicillin/streptomycin (Fisher Scientific, SV30010). Cells were incubated at 37°C and 5% CO2.
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mM L-Glutamine (ThermoFisher Scientific, #25030024), 1x MEM non-essential amino acids solutions (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 mL GlutaMAX (35050-079, Gibco). BE2 ...
-
bioRxiv - Cell Biology 2024Quote: ... or 5% normal goat serum (ThermoFisher, 31872) diluted into PBS to stain TMED9 ...
-
bioRxiv - Cell Biology 2024Quote: ... Hoechst 33342 (5 µg/mL; H3570, Invitrogen) was added to the secondary antibody solution and incubated for another 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% fetal bovine serum (FBS) (Gibco, 10099141), and 50 µg/ml gentamicin ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit anti-Claudin-5 (Thermo Fisher Scientific) 1:100 ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5mM EdU (5-ethynyl 2’-deoxyuridine, Invitrogen), 0.5mM EC (5-ethynyl cytidine ...
-
bioRxiv - Biochemistry 2024Quote: ... medium containing 5% fetal bovine serum (GIBCO). Plasmid DNA transfection was performed with Lipofectamine 2000 reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 % horse serum (GIBCO. 26050088), 1 % penicillin/streptomycin (GIBCO ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mM nicotinamide (Cat. #A15970.22, Thermo Scientific), and 500 nM SB202190 (Cat #202190 ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5% Horse serum (Gibco, USA), 0.5μg/μl Hydrocortisone (Himedia) ...
-
bioRxiv - Developmental Biology 2024Quote: ... supplemented with 5% calf serum (CS; Gibco) and 0.1 IU/mL recombinant human follicle-stimulating hormone (GONAL-F ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 g/L ammonium sulfate (ACROS organics), 1.9 g dropout synthetic mix complete without nitrogen base (US Biological) ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab11b - 5’-CUAACGUAGAGGAAGCAUUtt-3’ (Ambion, USA #4390824); Rab35 - 5’-GCAGUUUACUGUUGCGUUUtt-3’ (Ambion ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab11a - 5’-CAACAAUGUGGUUCCUAUUtt-3’ (Ambion, USA #4390824); Rab11b - 5’-CUAACGUAGAGGAAGCAUUtt-3’ (Ambion ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab35 - 5’-GCAGUUUACUGUUGCGUUUtt-3’ (Ambion, USA #4390824). The transfection of single siRNA or a combination of different siRNAs and the rescue of siRNA-treated cells with co-transfection of plasmid DNA and siRNA were completed according to the manufacturer’s (Invitrogen ...
-
bioRxiv - Genetics 2024Quote: ... 5 µl TaqMan Genotyping Master Mix (ThermoFisher), 0.5 µl of 20x assay probe ...
-
bioRxiv - Cell Biology 2024Quote: ... or 5 uM SYTO RNAselect (Thermo Fisher) was added directly to the dish for 30 minutes and then replaced with the reserved conditioned media just prior to imaging.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µl RNaseI (500 U, Ambion #AM2294) for 30 mins at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 ml of N2 (Thermo Fisher Scientific), 10 ml of B27 (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2024Quote: ... 5 ng/ml of hEGF (Life Technologies), 0.5 ng/ml of bFGF (Life Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... 5 % CO2 incubator for 5 hours before replacing the culture media with 2 mL B-DMEM (Thermofisher, cat. # 10566016) supplemented with 10 % FBS (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... desalted on a C8 column (Acclaim PepMap, 300 μm x 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific), and separated on a C18 column (Acclaim PepMap ...
-
bioRxiv - Cancer Biology 2022Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/ml [GIBCO], Dispase 5 mg/ml [GIBCO] ...
-
bioRxiv - Microbiology 2022Quote: ... at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic calf serum (Hyclone) ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 10 minutes and blocked with DPBS containing 5% BSA and 5% normal goat serum (Gibco), for 30 mins at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were rinsed 2 times for 5 minutes with PBS++ and incubated with 5 drops of NucBlue (Life Technologies) for 10 minutes ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 5 pmol was 5’-end labeled with 20 μCi of Ψ-P32 ATP using Polynucleotide Kinase (Thermo Fisher) and subsequently purified using an Illustra MicroSpin G-50 column (GE Healthcare) ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Biochemistry 2020Quote: ... UK) with an Acclaim PepMap C18 trap column (0.3 mm × 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific). The mobile phases were A ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μg total RNA were denatured for 5 mins at 95°C in RNA Gel loading dye (Thermo Scientific) before being separated on 1% agarose gels in 1X TBE (native ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR with primers p4 (5’ ATTTCAGTGG GACCTCAATGCC) and p5 (5’ GTGA CAGTCCAGGTGGAAACAAA) and Bpu10I digestion (Thermo Fisher Scientific #FD1184) was used to confirm the genomic differences between the KO + hTRIM28 and the KO + hTRIM28(S473A ...
-
bioRxiv - Genetics 2024Quote: ... and 5 µl were mixed with 5 µl of Power SYBR Green PCR Master Mix (Applied Biosystems Cat. # 4367659) containing 400 nM each of forward and reverse primer (S2 File) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and LCPNS-SIIN-Cxcl1KO cells were cultured at 37°C under 5% CO2 / 5% O2 in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12 medium, Gibco) supplemented with 1% N2 (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Above cells were split every 4-5 days using 5-10-minute incubation with 0.05% trypsin-EDTA (Thermo Fisher) at 37 °C ...