Labshake search
Citations for Thermo Fisher :
1701 - 1750 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg/ml leupeptin and 5 µg/ml E-64) and HALT phosphatase inhibitor (Thermo Fisher Scientific, Waltham, MA). Detergents were NP-40 or Brij 96V (both from Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... Above cells were split every 4-5 days using 5-10-minute incubation with 0.05% trypsin-EDTA (Thermo Fisher) at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR with primers p4 (5’ ATTTCAGTGG GACCTCAATGCC) and p5 (5’ GTGA CAGTCCAGGTGGAAACAAA) and Bpu10I digestion (Thermo Fisher Scientific #FD1184) was used to confirm the genomic differences between the KO + hTRIM28 and the KO + hTRIM28(S473A ...
-
bioRxiv - Genetics 2024Quote: ... and 5 µl were mixed with 5 µl of Power SYBR Green PCR Master Mix (Applied Biosystems Cat. # 4367659) containing 400 nM each of forward and reverse primer (S2 File) ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Cancer Biology 2023Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/mL [GIBCO], Dispase 5 mg/mL [GIBCO] ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μg total RNA were denatured for 5 mins at 95°C in RNA Gel loading dye (Thermo Scientific) before being separated on 1% agarose gels in 1X TBE (native ...
-
bioRxiv - Cell Biology 2023Quote: ... for 2–5 h at 37°C followed by a 5 min incubation in TrypLE express (Thermo Fisher Scientific) to generate small clumps of corneal endothelial cells ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
Spatiotemporal proteomics reveals the biosynthetic lysosomal membrane protein interactome in neuronsbioRxiv - Cell Biology 2024Quote: ... Peptides were loaded onto a trap column (C18 PepMap100, 5 μm, 100 Å, 5 mm × 300 μm, Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2024Quote: ... The iPSCs were fed every other day and were passaged 1:5-10 every 5 days using Versene (Invitrogen). All the protocol was approved by the Medical Research Ethics Committee of Wenzhou Medical University (2017-066 ...
-
bioRxiv - Microbiology 2024Quote: ... 5′ random amplification of cDNA ends (5′ RACE) was performed using the FirstChoice RLM RACE kit (Invitrogen™, #AM1700M) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Thawed PBMCs were centrifuged (500g, 5 minutes) and the cell pellet was resuspended in 5 mL of DPBS (Gibco). Cells were counted as described above ...
-
bioRxiv - Microbiology 2024Quote: ... centrifuged at 5 000×g for 5 min at 4°C in SpinX 0,2 µm tubes (Corning, Fisher Scientific) for cell debris and bacterial removal ...
-
bioRxiv - Neuroscience 2024Quote: ... The synaptosomes were labelled with 5 µM of CellTrackerTM Green CMFDA (5-chloromethyl fluorescein diacetate; Thermo Fisher; Cat# C7025) for 30 minutes at 37°C as an internal control dye marker ...
-
bioRxiv - Pathology 2024Quote: ... according to manufacturer specifications in the presence of 10mM 5-Bromo-2’-Deoxyuridine 5’-Triphosphate (BrdUTP, Thermo Scientific, B21550), at 37°C in a dark humidified slide box for 90 minutes ...
-
bioRxiv - Physiology 2024Quote: ... 40 cycles of 95°C for 5 sec and 60°C for 60 sec using QuantStudio 5 (Applied Biosystems). The relative quantity of each gene was calculated using ΔΔCT method with 36B4 as endogenous control.
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mM EDTA, 5 mM MgCl2, 1% NP-40, 0.5 mM DTT, 1X protease and phosphatase inhibitor cocktail; ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... and passaged every 3–5 days after approximately 5 minutes of incubation with 0.5 mM EDTA (15575020, Life Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Microbiology 2021Quote: ... Cell-free supernatants were diluted to 8 mg/mL and 5 µL of sample was combined with 5 µL of NovexTM Tris-Glycine SDS Sample Buffer (Invitrogen) to load 40 µg per well ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beas-2B cells were cultured at 37°C in a humidified atmosphere of 5% in serum-free 1× defined keratinocyte SFM Gibco) supplemented with 5 µg/mL gentamicin (Gibco). The medium was replaced every 2–3 days and cells were passaged every 4–5 days ...
-
bioRxiv - Microbiology 2022Quote: ... Health and Nutrition (Japan) and cultured at 37 °C with 5% CO2 in DMEM (WAKO) containing 5% fetal bovine serum (Gibco) and penicillin/streptomycin (100 U/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... Digests were allowed to stand for 5 min at room temperature and the supernatants were added to 5 ml of foetal bovine serum (FBS; Gibco) on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Triton X-100 for 5 min and incubated with a blocking buffer containing PBS and 5% normal goat serum (31873; Invitrogen) for 1 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then centrifuged at 400 rcf for 5 minutes and resuspended in cold flow cytometry buffer (calcium free HBSS with 5% fetal bovine serum (FBS, Gibco), 2 mM EDTA ...
-
bioRxiv - Immunology 2021Quote: ... mice were woken up to allow any fecal matter to evacuate and then anesthetized again to introduce 100μL of Cy-5-labelled glucose or Cy-5 secondary goat anti-rat antibody (0.1mM diluted in PBS, ThermoFisher A10525) into the colon via a gavage needle enema ...
-
bioRxiv - Molecular Biology 2021Quote: ... falciparum Dd2 was cultured at 2-5% hematocrit in O+ erythrocytes in Malaria Culture Medium (MCM): RPMI 1640 supplemented with 5 g/L Albumax II (Gibco), 0.12 mM hypoxanthine (1.2 mL 0.1M hypoxanthine in 1 M NaOH) ...
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... The coverslip with the sample was then inverted into the center of an imaging dish containing 150 μL of imaging buffer (Tyrode’s with 5% cosmic calf serum and 5 μg/mL Hoechst 34580 (Invitrogen #H21486), mixed by pipette and vortexed ...
-
bioRxiv - Neuroscience 2020Quote: ... a selected cell terminal was puffed for 5 s with a solution containing 3-5 μM FM1-43 (Molecular Probes) and (in mM) ...
-
bioRxiv - Biochemistry 2021Quote: ... Fractions were loaded onto a cartridge precolumn (5 mm x ID 300 μm, C18 PepMap 100 A, 5 μm particles (ThermoFisher)) ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were injected onto a PepMap100 trap column (0.3 x 5 mm packed with 5 μm C18 resin; Thermo Scientific), and peptides were separated by reversed phase HPLC on a BEH C18 nanocapillary analytical column (75 μm i.d ...
-
bioRxiv - Biochemistry 2020Quote: ... Peptides were trapped and desalted on a C18-column (5 μm Acclaim PepMap100 300 μm x 5 mm, ThermoFisher Scientific) at a flow rate of 30 μl/min with solution A (1% acetonitrile (ACN) ...
-
bioRxiv - Microbiology 2020Quote: ... cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 5% FBS at 37°C and 5% CO2 along with penicillin and streptomycin antibiotics (Gibco).
-
bioRxiv - Microbiology 2021Quote: ... One milliliter of the culture was incubated for 5 min (at 37°C) with the membrane dye Nile Red (5 µg/ml, Invitrogen), washed once with phosphate buffered saline (PBS) ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were loaded onto the trap column (C18 PepMap100, 5 μm particle size, 300 μm x 5 mm, Thermo Scientific) for 4 min at 18 μl/min ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Cell Biology 2022Quote: ... site-directed mutagenesis was performed as described in Liu & Naismith (32) using primers 5’-ACTACTTCGATGAGATCGCTCTGCTCATGAACCGTCCTCGTGCTG and 5’-AGCGATCTCATCGAAGTAGTCAGACGGTGCGAGTCTTCCAACCTC using Phusion Plus DNA polymerase (#F630S, ThermoFisher). Following confirmation of the RIαB G323D mutation by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... They have been regularly screened for mycoplasma infection using a PCR-based method with the primers Myco1 (5’-GGCGAATGGGTGAGTAACACG) and Myco2 (5’-CGGATAACGCTTGCGACTATG) (Invitrogen) and no cultures have tested positive.
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Developmental Biology 2022Quote: RNA was extracted from an isolated two-kidney pool from each litter of the NP (n = 5) and LP (n = 5) offspring using Trizol reagent (Invitrogen), according to the instructions specified by the manufacturer ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were pelleted one last time at 400 x g for 5 min and resuspended into 5 ml of PBS (GIBCO) supplemented with protease inhibitors (ThermoFischer Scientific) ...