Labshake search
Citations for Thermo Fisher :
1651 - 1700 of 10000+ citations for Adenovirus Type 5 Particles CMV β galatosidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... adjusted in HAAKE Falling Ball Viscometer type C (Thermo Fisher Scientific, Dreieich, Germany) using ball number 3 to a viscosity of 15 mPa s ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells expressing wild-type or mutant GlyT2 grown in 6 well plates (Nunc) were washed and labeled with Sulfo-NHS-Biotin (1.0 mg/ml in PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and incubated with 10 mg/mL collagenase type I (Gibco, Amarillo, TX, USA) under agitation at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... The plasmids were introduced into the two cell types using Lipofectamine (Gibco-BRL) according to the manufacturer instruction ...
-
bioRxiv - Pathology 2020Quote: ... 1.6 mg/ml collagenase type I in HBSS without Ca2+ and Mg2+ (Gibco) at 37 %C for 25-30min.
-
bioRxiv - Cancer Biology 2020Quote: ... and transfected to wild-type MDA-MB-231 cells using Lipofectamine 3000 (Invitrogen) in serum-free OptiMEM medium (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... The testes were then digested with 1 mg/ml type 4 collagenase (Gibco), 1 mg/ml hyaluronidase (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... Total RNA was extracted from wild-type or Nopp140−/− larvae using TRIzol (Invitrogen) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... The tissues were digested for 40 min using type I collagenase (Invitrogen, USA) at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... lymph nodes were enzymatically digested with 100U/mL of collagenase type II (Gibco) at 37°C for 30 min to liberate lymphocytes and antigen-presenting cell populations ...
-
bioRxiv - Immunology 2021Quote: ... and 80 U mL-1 DNase type I (ThermoFisher Scientific, Waltham, MA, USA) for 25 min in a 37°C shaking incubator ...
-
bioRxiv - Developmental Biology 2020Quote: ... mutant and wild type limb buds were pooled and homogenized in Trizol (Invitrogen) using a 25g needle ...
-
bioRxiv - Cell Biology 2021Quote: ... a collagen sheet containing 2% DQ-collagen type I (D12060, Thermo Fisher Scientific) was used ...
-
Cardiac pericytes are necessary for coronary vasculature integrity and cardiomyocyte differentiationbioRxiv - Physiology 2022Quote: ... hearts were dissociated using 2 mg/mL type IV collagenase (Gibco™, ThermoFisher) for 1 hour at 37°C and the resulting dissociated cells were filtrated on a 30 µm strainer ...
-
Cardiac pericytes are necessary for coronary vasculature integrity and cardiomyocyte differentiationbioRxiv - Physiology 2022Quote: ... hearts were dissociated using 2 mg/mL type IV collagenase (Gibco™, ThermoFisher) for 1 hour at 37°C and the resulting dissociated cells were filtrated on a 30 µm strainer ...
-
bioRxiv - Neuroscience 2022Quote: ... Two types of media were used: KSR medium (KnockOut DMEM (Thermo Fisher, 10829018) and 15% KnockOut Serum Replacement (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: 1mg/ml type-I collagen gels were made from rat tail collagen (Gibco) as previously described in a 96-well plate (Schuh et al ...
-
bioRxiv - Microbiology 2023Quote: ... for adipose fat or 2 mg/mL collagenase type 2 (ThermoFisher Scientific, 17101015) for lung samples ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell types were cultured in Dulbecco’s Modified Eagle’s medium (DMEM, Gibco, 21969035) supplemented with 10 % fetal bovine serum (FBS ...
-
bioRxiv - Biophysics 2023Quote: ... and vessel type) was exported and stored in Amira spatial graph format (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... which was prepared by mixing rat tail type 1 collagen (Thermo Fisher Scientific), 10X DMEM medium ...
-
bioRxiv - Genomics 2023Quote: ... using the Standard Curve experiment type and SYBR Green Master Mix (ThermoFisher 4309155). Each qPCR condition was conducted with triplicate repeats and the data was analyzed using the 2^-ΔΔCT method where each CUT&Tag sample was normalized to qPCR levels of K562 genomic DNA (gDNA ...
-
bioRxiv - Immunology 2023Quote: ... and then digested with 1mg/ml Collagenase Type II (Gibco Cat # 17101-015) in HBSS with calcium and magnesium at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: Wild-type mouse ES cells were electroporated using the Neon transfection system (Invitrogen) using 3 × 1400V for 10 ms with 2.5 μg of the two sgRNA nickase-Cas9 plasmids and 5 μg targeting vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... hydrogel was incubated in complete media with 1% collagenase type I (ThermoFisher, 17100017) for 25-30 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... 330 µl of rat tail type-I collagen (3 mg/ml; Gibco A1048301) was gently diluted in 660 µl 1X PBS for a final collagen concentration of 1 mg/ml ...
-
bioRxiv - Biochemistry 2023Quote: ... wild-type and mutant proteins were expressed in Expi293F cells (Thermo Fisher Scientific) using the same protocol.
-
bioRxiv - Immunology 2024Quote: ... followed by the digestion with 0.05% collagenase type IV (Gibco/Thermo Fisher Scientific) in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Immunology 2024Quote: ... followed by the digestion with 0.05% collagenase type IV (Gibco/Thermo Fisher Scientific) in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Immunology 2023Quote: ... treated with pre-mixed enzyme solution containing type I collagenase (Gibco, Grand Island) and trypsin (Gibco ...
-
bioRxiv - Immunology 2023Quote: Wild-type and mutant KSHV-GPCR were cloned into the pcDNA3.1(+) vector (Invitrogen). The coding sequences were chemically synthesized (General Biol ...
-
bioRxiv - Bioengineering 2024Quote: ... Tissues were digested in 3 mg/mL type II collagenase (17101-015, Gibco) reconstituted in culture media for one hour at 37°C followed by digestion in 0.5 mg/mL type II collagenase overnight at 37°C ...
-
bioRxiv - Biophysics 2020Quote: ... 0.1 M NaCl and 1% n-Dodecyl β-D-maltoside (DDM, Anatrace, Affymetrix) and stirred for 18 hours for solubilization ...
-
bioRxiv - Cell Biology 2020Quote: ... Data were normalised to the probe for housekeeping gene β-Actin (Thermo Fisher). Primer sequences were obtained from a previously published paper by Kazuo et ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μg/ml streptomycin and 50 μM β-mercaptoethanol (all from Gibco, Invitrogen) supplemented with 5% supernatant of an Flt3L producing cell line and 1 μM estrogen (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μg/ml streptomycin and 50 μM β-mercaptoethanol (all from Gibco, Invitrogen) supplemented with 5% supernatant of an Flt3L producing cell line and 1 μM estrogen (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... Recombinant protein expression was triggered using 0.5mM isopropyl β-D-1-thiogalactopyranoside (ThermoFisher) and incubated for 18 h in an orbital shaker at 18 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The cultures were induced with 1 mM isopropylthio-β-galactoside (IPTG) (Life Technologies) and grown for 4 h at 30°C ...
-
bioRxiv - Microbiology 2022Quote: ... expression was induced with addition of Isopropyl-β-D-thiogalactopyranoside (IPTG) (Fisher Scientific) and the cultures were grown for an additional 20 hours at 18 °C.
-
bioRxiv - Immunology 2022Quote: ... 1x non-nonessential amino acids (all Biochrom) and 100 μM β-mercaptoethanol (Gibco). After 24 h ...
-
bioRxiv - Microbiology 2020Quote: ... and PDGF-D by enzyme-linked immunosorbent assay (ELISA, TGF-β: Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... to knockdown β-catenin using Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen™, 13778150). For TopFlash reporter assay ...
-
bioRxiv - Microbiology 2020Quote: ... we used a β-actin gene specific forward primer “CGGCCTTGGAGTGTGTATTAAGTA” (Invitrogen, Carlsbad, CA) and reverse primer “TGCAAAGAACACGGCTAAGTGT” (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: Mouse TGF-β 1 recombinant protein was obtained from Affymetrix (#14-8342-62) and used at the concentration of 2 ng/ml unless stated otherwise ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μg of protein plus LDS Sample buffer/10% β-mercaptoethanol (Invitrogen NP0007) were separate by PAGE on a 4–12% Bis-Tris polyacrylamide gel (Biorad 3450125) ...
-
bioRxiv - Immunology 2019Quote: ... 500 U penicillin-streptomycin (PAA laboratories) and 50 μM β-mercaptoethanol (Life Technologies). To polarize the cells towards a Th17 phenotype ...
-
bioRxiv - Immunology 2019Quote: ... 500 U penicillin-streptomycin (PAA laboratories) and 50 μM β-mercaptoethanol (Life Technologies). For Th17 induction ...
-
bioRxiv - Genetics 2019Quote: ... 150 mM β-mercaptoethanol) and quantified using A280 from a NanoDrop (Thermo Scientific). 40-50μg of protein was analysed by SDS–polyacrylamide gel electrophoresis (SDS–PAGE ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 1X MEM nonessential amino acids and 0.01 mM β-mercaptoethanol (ThermoFisher, Waltham, MA). Sensory neuron differentiation began on day 2 with the addition of 3 μM CHIR99021 ...
-
bioRxiv - Physiology 2021Quote: ... Lipocalin-2 Lcn2 and house-keeping gene β-Actin (Life Technologies, Carlsbad, CA). The CT value for the gene of interest was first normalised by deducting CT value for β-Actin to obtain a delta CT value ...