Labshake search
Citations for Thermo Fisher :
1601 - 1650 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... with 3% (v/v) acetonitrile (Thermo Fisher, Cat. No. A996SK-4) and B was 100% acetonitrile ...
-
bioRxiv - Immunology 2022Quote: The production of NO was evaluated using 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-FM DA)(D23844; Invitrogen, Waltham, MA). Following leukocyte isolation ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then washed 4-5 times in PBS for 2 hours and mounted onto glass slides using ProLong Gold Antifade Mountant (Invitrogen; Cat #P36930). Sections were imaged on a Leica SP8 upright confocal laser scanning microscope using a X10/NA 0.45 objective ...
-
bioRxiv - Microbiology 2023Quote: The RBDs of G614, Alpha, Beta, and Omicron (BA.1, BA.2, BA.4/5) variants were ordered as GeneString from GeneArt (Thermo Fisher Scientific). All sequences of the RBD (aa 319-541 in GenBank ...
-
bioRxiv - Physiology 2023Quote: ... and incubated for a period of 1 h in a dark room in 2 ml of extracellular solution containing 5 µM fluo- 4 AM (Thermo Fisher Scientific) or 7 µM Corona Green AM (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 5% Fetal Bovine Serum (FBS), 4°C) and incubated (37°C, 2 minutes) in protease solution (TrypLE express, Thermo Fisher 12604013) supplemented with DNase (100 U/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of cells were collected by centrifugation at 1500 rpm for 5 min at 4°C and stained with anti-SARS-CoV-2 RBD antibody (Invitrogen, PA5-114529). After centrifugation ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 to 4 µL was injected onto an Acclaim PepMap 100 column packed with 2 cm of 5 µm C18 material (Thermo Fisher, 164564) using 0.1% formic acid in water (solvent A) ...
-
bioRxiv - Cell Biology 2024Quote: Cells (2 – 5 x 106) were washed two times with cold PBS and lysed with RIPA buffer at 4°C (Thermo Fisher Scientific) supplemented with protease inhibitor (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... and the phosphate concentration is determined from the fluorescence increase through binding of phosphate to the phosphate sensor (0.5 µM; Thermo Fisher). PdeL and c- di-GMP concentrations were used ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Microbiology 2022Quote: ... and L plasmids at a ratio of 4:2:2:2:1 using Lipofectamine 2000 (ThermoFisher Scientific). Cells were transfected in 6 well plates and subsequently transferred to T25 flasks with HEp2 cells until cytopathic effect (CPE ...
-
bioRxiv - Biophysics 2022Quote: ... blotted for 4-6 s at 4°C and 100% humidity using a FEI Vitrobot Mark IV (Thermo Fisher Scientific), and plunge frozen in liquid ethane ...
-
bioRxiv - Biophysics 2022Quote: ... blotted for 4-6 s at 4°C and 100% humidity using a FEI Vitrobot Mark IV (Thermo Fisher Scientific), and plunge frozen in liquid ethane ...
-
bioRxiv - Biophysics 2024Quote: ... and blotted for 4-6 s at 4°C and 100% humidity using the Vitrobot Mark IV system (Thermofisher Scientific), before plunging immediately into liquid ethane for vitrification ...
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...
-
bioRxiv - Immunology 2021Quote: ... Glucose uptake was measured by the uptake of glucose analogue 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG, Life Technologies). Cell surface and intracellular cytokine stainings of splenocytes and blood lymphocytes were performed as described (42) ...
-
bioRxiv - Physiology 2020Quote: ... 1 mM fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Life Technologies) was diluted in Live Cell Imaging Solution (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: Cellular glucose uptake was measured by culturing cells in glucose free DMEM for 2 hours before adding 100µM of the fluorescent glucose analogue 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl) Amino)-2-Deoxyglucose (2-NBDG; ThermoFisher, N13195). The analogue was incubated with MCF7s for 30 minutes and MSCs for 60 minutes at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were dehydrated by sequential submersion in 100% ethanol (2× 5 min) and SafeClear II (2× 5 min, Fisher Scientific) before being mounted in Cytoseal 60 (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 52h after plating 5 µM 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was added for 20 h ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then incubated overnight at 4°C in blocking solution (PBS, 2% normal goat serum, 3% BSA) and primary antibodies (mouse anti-HA, Invitrogen; rabbit anti-GFP, Invitrogen). Cells were then immunolabeled with Alexa-conjugated secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 vein graft slide containing 2-4 cross sections was double stained with the general macrophage marker Mac-3 (rat anti-mouse, Fisher Scientific, B550292, 1:600) and either iNOS (rabbit anti-mouse ...
-
bioRxiv - Immunology 2024Quote: ... differentiated Th2 cells were restimulated with anti-mouse CD3 (4 µg/mL) for 3 hours followed by 2 hours of incubation with monensin (Thermo Fisher Scientific, MA, USA) at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Microbiology 2021Quote: ... 6- diamidino-2-phenylindole dihydrochloride (DAPI; Thermo Fisher D1306; 1:1,000 dilution) for 20 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... in blocking buffer containing 4ʹ,6-diamidino-2-phenylindole (DAPI; 1;1,000, Invitrogen). After staining ...
-
bioRxiv - Cancer Biology 2021Quote: ... Nuclei (DNA) were stained with 6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen). Slides were embedded with Mowiol (0.33 g/ml glycerol (Sigma-Aldrich 15523-1L-R) ...
-
bioRxiv - Neuroscience 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 50 μg/ml, D1306; Thermo Fisher Sci) was added to visualize the cell nuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 6-diamidino-2-phenylindole were purchased from Invitrogen (Carlsbad, CA, USA). Additionally ...
-
bioRxiv - Neuroscience 2024Quote: 6-8 dpf larvae were embedded in 2% low melt agarose (Invitrogen) on 100 mm square (Thermo Scientific (cat# 109-17) ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, 50 μg/ml, D1306; Thermo Fisher Sci) was added to visualize the cell nuclei ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, 50 μg/ml, D1306; Thermo Fisher Sci) was added to visualize the cell nuclei ...
-
bioRxiv - Biophysics 2024Quote: ... The fluorescent dye 6-dodecanoyl-2-dimethylaminonaphthalene (LAURDAN) was purchased from Thermofisher Scientific (USA) ...
-
bioRxiv - Cell Biology 2024Quote: ... 10µM of laurdan probe (6-Dodecanoyl-2-Dimethylaminonaphthalene) (Thermofisher, Cat no. D250) was added to the cells in RPMI 1640 (1x ...
-
bioRxiv - Bioengineering 2024Quote: ... 6-diamidino-2 phenylindol (DAPI, 1 ug/mL; Thermo Fisher, Waltham, MA), and AlexaFluor 488 phalloidin (1:100 ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from 6 pairs of P21 mouse testes (3 pairs of wild type and 3 pairs of Mov10-/-) using TRIzol reagents (Thermo Fisher Scientific). 1 μg of total RNA from each sample was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Preparation Kit Set A (Cat ...
-
bioRxiv - Biophysics 2024Quote: ... phosphate buffered saline (Gibco), trypsin (0.05 % ...
-
bioRxiv - Neuroscience 2022Quote: ... brain slices were washed (5 min at RT x 3 times) in PBS and incubated (overnight at 4°C) with streptavidin-Alexa 488 (ThermoFisher Scientific, S-11223, 1:500) in PBS-triton 0.05% ...
-
bioRxiv - Physiology 2022Quote: ... The samples were then mixed with 1 mL of a 3:13 solution of Ehrlich’s reagent (1.5 g of 4-[dimethylamino] benzaldehyde [ThermoFisher]; 5 mL ethanol; 337 µL sulfuric acid) to isopropanol and incubated for 30 min at 58°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge, Thermo Fisher Scientific, Darmstadt, Germany). The fluorescence intensity of the supernatant was measured measured (485 nm excitation ...
-
bioRxiv - Cancer Biology 2021Quote: ... EdU 10μM (5-ethynyl-2’-deoxyuridine, ThermoFisher Scientific) diluted in fresh medium was added in the well for 10 minutes (MIA PaCa-2) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... loaded with 5 μM Rhod-2,am (ThermoFisher) in a zinc-containing HEPES-based salt solution (HBSS ...
-
bioRxiv - Molecular Biology 2021Quote: ... EdU (5-ethynyl-2’-deoxyuridine, Invitrogen, cat# A10044) was dissolved in PBS at 0.5 µg/µl and injected intraperitoneally into mice at 5 µg/g body weight 24 h before harvesting ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’– deoxyuridine (27) (Invitrogen, Cat# A10044) was administered through drinking water (0.5mg/ml) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3μM EdU (5-ethynyl-2′-deoxyuridine, A10044 Invitrogen) was added to the culture for 48h in the following time window ...