Labshake search
Citations for Thermo Fisher :
1501 - 1550 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 20% volume of 1M 2-morpholin-4-ylethanesulfonic acid (MES) pH 5 and Immobilized Protein G resin (Thermo Scientific Prod#20397) were added to supernatant and sample was incubated overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells nuclei were counter-stained using 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI) mounting medium (ProLong™ Diamond Antifade Mountant with DAPI, Thermo Fisher Scientific, Warsaw, Poland). Preparations were observed using the confocal microscope under magnification 630× and processed with Fiji software (ImageJ 1.52n ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and mounted immediately after onto glass slides coated with gelatin in Fluoromont-G with 4’,6-diamidino-2-phenylindole (DAPI) (00-4959-52, Invitrogen, Thermo Fisher Scientific, MA, USA) as counterstaining.
-
bioRxiv - Bioengineering 2024Quote: ... Tissue sections were stained with hematoxylin and eosin (H&E) or mounted with 4′,6-diamidino-2-phenylindole (DAPI) Fluoromount-G (Thermo Fisher Scientific, Waltham, MA, USA). They were imaged with SLIDEVIEW VS200 Slide Scanner (Olympus ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; 5 mg per kg body weight, Invitrogen) dissolved in sterile phosphate buffer solution (PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... С6 and CHO/5-HT2C were maintained in the F12 medium (Invitrogen). In all cases ...
-
bioRxiv - Bioengineering 2024Quote: ... Coupling 5-(and 6)-Carboxytetramethylrhodamine (TAMRA) mixed isomers (Thermo Scientific, Waltham, MA) and Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-PEG2-OH ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were split every 5-6 days using TrypLE Express (Gibco, #12604013). Each dome required 20-25mins in TrypLE Express with manual pipetting for successful dissociation ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 µl Klenow-Fragment exo-polymerase (Thermo Fisher, 5 U/µl) were added ...
-
bioRxiv - Neuroscience 2024Quote: ... 5-6 dpf zebrafish were paralyzed with alpha-bungarotoxin (Fisher Scientific, B1601) dissolved at the concentration of 0.5 - 1 mg/ml in external solution (in mM ...
-
bioRxiv - Developmental Biology 2024Quote: ... qPCR was performed using FastSYBRGreen 5× MasterMix on a QuantStudio 6 (Invitrogen). Primers were obtained from IDT (Supplementary Table 4) ...
-
bioRxiv - Immunology 2022Quote: Caspase-3 activity was determined using EnzChek™ Caspase-3 Assay Kit #2 (Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... (75 mm i.d. 3 2 cm, Acclaim PepMap100 C18 3 mm, 100 A°, ThermoFisher Scientific) and separated over an EASY-Spray column ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]- D-glucose (2-NBDG) (Invitrogen N13195) was used as a probe for monitoring glucose uptake ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were infected in a BSL-3 lab with the UF-1 strain of SARS-CoV-2 at MOI of 4 in media containing 3% low IgG FBS (Fisher Scientific, Cat. SH30070.03).
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated at 4°C for 3 hours on a rotator before being placed in a DynaMag™-2 magnetic rack (Thermo Scientific, 12321D) and washed twice with TBS+NP40 wash buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... Fluorescence-labelled 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (NBD-PE) was obtained from Molecular Probes (Eugene, Oregon, US). Sucrose was purchased from XiLong Chemical Co. ...
-
bioRxiv - Bioengineering 2020Quote: ... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ...
-
bioRxiv - Neuroscience 2021Quote: ... passaged 1:2-3 when confluent using Tryple (ThermoFisher). When thawing or passaging the iPSCs ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM 2-deoxy-D-glucose (2DG; ACROS Organics), 2 μM PERK inhibitor (PERKi ...
-
bioRxiv - Plant Biology 2022Quote: ... 2–3 μg were treated with Turbo DNase (Ambion). RNA was circularized using T4 RNA ligase and reverse transcription was performed with the Superscript III (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... glass (2 gm, 3 mm bead diameter; Fisher Scientific) and polystyrene (24-well plates ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse-anti-desmocollin-2/3 7G6 (1:250, Invitrogen 32-6200 ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-2 drops of CytoSeal (Thermofisher, 8312-4) were placed on each before mounting a coverslip ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2-4 μg/ml of Blastidin (ThermoFisher Scientific) and 100-400 μg/ml of G418 (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... Puromycin (2-4 μg/ml, Thermo Fisher, A113803) was used for TRIM25-knockdown HEK293T cell selection ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 ng/ml BMP-4 (ThermoFisher Scientific). Then ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Genomics 2021Quote: Worms were individually washed with 2 mL of PBS (Phosphate Buffered Saline, pH 7.4 Life Technologies) to remove potential remaining contaminants from the fish ...
-
bioRxiv - Developmental Biology 2022Quote: ... 200 µM L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate and 1% Penicillin/Streptomycin (ThermoFisher Scientific), 1 µmol/L Glucose ...
-
bioRxiv - Genomics 2022Quote: ... Samples were resuspended in phosphate buffered saline (PBS) supplemented with 2% fetal bovine serum (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted and quantified from WwoxWT/WT and WwoxP47T/P47T n=6 mice/group (3 males and 3 females) and cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in 2-(N-(7-nitrobenz-2-oxa-1,3-diaxol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Invitrogen) (20 µM ...
-
bioRxiv - Physiology 2021Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in saline solution at 5 mg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (100 μM; ThermoFisher Scientific) with Hoechst (1 μg/mL ...
-
bioRxiv - Immunology 2020Quote: ... Glucose uptake assay was performed by incubating cells with 50 µM 2-NBDG (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose) (Invitrogen) for 90 min at 37°C prior to cell staining ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended in glucose-free media containing 150 μM 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG Thermofisher) and incubated for 45 minutes at 37°C.
-
bioRxiv - Neuroscience 2024Quote: ... 5% CO2 in GFD medium supplemented with 5 mM L-glucose and 1 mM 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-D-glucose (2-NBDG; Invitrogen). Finally ...
-
bioRxiv - Cell Biology 2024Quote: Cells were transfected and 24h later treated with 250µM or 500µM of glucose fluorescent analogue 2-NBDG (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose) (#N13195, Thermofisher) in Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Microbiology 2020Quote: ... The sporozoite-infected culture was maintained for 3 or 5 or 7 days after which the cells were fixed with 4% paraformaldehyde (ThermoFisher Scientific: catalogue number 28906) for 10 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... HCT8 cells were grown on a 6-well slide (3×105/well, Thermo Scientific) overnight ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293T cells (3×105) were seeded in a 6 well plate (Nunc,Thermo,USA) with DMEM media (Invitrogen,USA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Slices were finally incubated for 3-6 minutes with DAPI (1:10 000, Invitrogen) diluted in PBS and mounted on Polysine® Slides stored at 4°C until imaging.
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Neuroscience 2024Quote: ... membranes were transferred into clean 6-well plates with ice cold phosphate-buffered saline with magnesium and calcium (PBS-MC Gibco; 14040141). Somata were then dislodged from the upper surface of the membrane through gentle trituration with ice-cold PBS ...