Labshake search
Citations for Thermo Fisher :
1551 - 1600 of 3690 citations for CdSeTe ZnS Quantum Dots NIR region Water solvent 760nm since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and UltraPure DNase/RNase -free distilled water were purchased from Fisher Scientific. Ammonium tetrathiomolybdate (TTM) ...
-
bioRxiv - Pathology 2024Quote: ... RNA was eluted twice with RNase-free water (Thermo Fisher Scientific, UK). The total RNA yield was measured using a NanoDrop® ND-1000 Spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Water was quickly replaced with 5% 3kDa Texas red dextran (Life Technologies) in dH2O ...
-
bioRxiv - Microbiology 2024Quote: ... Waters) integrated with a Dionex Ultimate 3000 UHPLC system (Thermo Fisher Scientific). Mobile phase A and B were comprised of methanol ...
-
Spatial 3D genome organization controls the activity of bivalent chromatin during human neurogenesisbioRxiv - Neuroscience 2024Quote: ... washed with D-PBS and water and mounted with prolong glass (Invitrogen). Samples were left in dark overnight at room temperature to let it cure before imaging.
-
bioRxiv - Systems Biology 2024Quote: ... and water with 0.1% FA (MS grade) were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Bioengineering 2024Quote: ... unfiltered human plasma from healthy participants collected into K2 EDTA anticoagulant was acquired from BIOIVT (HUMANPLK2-0000283) and diluted 1:4 in nuclease-free water (Invitrogen, AM9937). Plasma was spiked with DOR dilutions in DMSO for final DOR concentrations spanning 8 orders of magnitude matching the DOR-spiked buffer concentrations (10-3 M to 10-10 M) ...
-
bioRxiv - Developmental Biology 2024Quote: ... in 1μl of pure water (Optima LC/MS Grade, Fisher Scientific, W6500).
-
bioRxiv - Biochemistry 2024Quote: ... DEPC-treated water was prepared in house by adding diethylpyrocarbonate (Fisher Scientific) to a final concentration of 0.1 % ...
-
bioRxiv - Biophysics 2024Quote: ... the dye is dissolved into water-free DMSO (Thermo Fisher, MA, USA) to a concentration of 10 mM ...
-
bioRxiv - Bioengineering 2024Quote: ... 8 µL of RNase-free water (Thermo Fisher Scientific, Waltham, MA, USA) and 10 µL of 1X RNA loading dye ...
-
bioRxiv - Biochemistry 2024Quote: ... LC/MS grade water and formic acid were obtained from Thermo Fisher. All used chemicals were of analytical grade.
-
bioRxiv - Developmental Biology 2024Quote: ... in 1μl of pure water (Optima LC/MS Grade, Fisher Scientific W6500).
-
bioRxiv - Plant Biology 2024Quote: ... Alcohol Insoluble Materials (AIMs) were extracted from 20 to 30 mg of lyophilised root tissues using Dionex™ ASE™ 350 accelerated solvent extractor (Thermo Fisher Scientific Inc., Waltham, MA, USA). The identification and quantification of cell wall neutral sugars were performed by gas-chromatography (Trace GC Ultra ...
-
bioRxiv - Microbiology 2021Quote: ... concentrated in vacuo and purified by HPLC (Waters 2695 Separation module and Waters 2998 PDA detector) using a C18 column (Thermo Scientific Hypersil GOLD C18 5 μm, 250×4.6 mm) with a column guard with 20 mM ammonium bicarbonate / acetic acid ...
-
bioRxiv - Cancer Biology 2021Quote: DNA templates for Nucleolin-bound regions were PCR amplified and in-vitro transcribed with MEGAshortscript T7 transcription kit (Thermo Fisher Scientific). In-vitro transcribed products and chemically synthesized 5’-tRFCys (Integrated DNA Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... Cryo-EM data in selected grid regions were collected in-house on a 200-keV Talos Arctica microscope (Thermo Fisher Scientifics) with a post-column energy filter (Gatan ...
-
bioRxiv - Neuroscience 2021Quote: ... we designed more than 2 pairs of PCR primers in the 5’ and 3’ untranslated regions and inserted all resulting PCR products into pCR-Blunt-TOPO vector (Thermo Fisher). The TOPO-transcript vectors of the same gene were sequenced and compared to verify that no error was introduced to the coding sequence during reverse transcription ...
-
bioRxiv - Neuroscience 2021Quote: ... cervical spinal cord regions were frozen into Tissue-Tek OCT solution and sectioned at 30 μm using a cryostat (Thermo Scientific) and placed onto charged glass slides.
-
bioRxiv - Molecular Biology 2020Quote: ... S2 cells grown in SFX medium were co-transfected by 3xFLAG-Pita (wild-type and with deletion of CP190-interacting region) and CP190 plasmids with Cellfectin II (Life Technologies), as recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... S2 cells grown in SFX medium were co-transfected by 3xHA-dCTCF (wild-type and with deletion of CP190-interacting region) and CP190 plasmids with Cellfectin II (Life Technologies), as recommended by the manufacturer ...
-
bioRxiv - Genetics 2020Quote: ... A DNA fragment containing 200 bp of upstream HO flanking region and 200 bp of the HO gene was synthesized by Life Technologies and cloned into pGEM®-T Easy (Promega Corp. ...
-
bioRxiv - Bioengineering 2021Quote: ... nanobody sequences were PCR amplified with primers containing terminal regions of homology for cloning into a pRset plasmid (Addgene plasmid 3991)(Invitrogen, V35120) in frame and linked to mCherry ...
-
bioRxiv - Neuroscience 2021Quote: ... the calcium buffer electrode was withdrawn and the same axon was impaled just distal to the region of measurement with a second electrode filled with Alexa Fluor 594 Hydrazide conjugated Phalloidin (Life Technologies). The phalloidin was pressure injected into the axon and imaging was carried out after 10- 15 minutes allowing for the phalloidin to label presynaptic actin46 and a z stack acquired ...
-
bioRxiv - Cancer Biology 2020Quote: ... Images of at least five different grid regions were acquired per experimental condition on a Talos F200X TEM (Thermo Fisher Scientific) equipped with a Ceta 16M camera operated at an accelerating voltage of 200 kV ...
-
bioRxiv - Plant Biology 2021Quote: ... a 280 bp region of PHYB was amplified using the dCAPS primers (Supplemental Table 2) with DreamTaq polymerase (Thermo Fisher Scientific) and subsequently digested with ApoI-HF (New England Biolabs ...
-
bioRxiv - Plant Biology 2021Quote: ... and ABCG19 coding regions and as well as ABCG17 and ABCG18 promoter fragments were cloned into pENTR/D-TOPO (Invitrogen K2400), verified by sequencing ...
-
bioRxiv - Genomics 2021Quote: ... to cut non-methylated GATC sites and prevent amplification of unmethylated regions and purified with a 1:1.5 ratio of Seramag beads (Fisher Scientific, 65152105050250). PCR amplification of DpnII-digested fragments using MyTaq (Bioline ...
-
bioRxiv - Cell Biology 2021Quote: 5ʹUTR of Prdx6-202 transcript regions with either the wild-type or mutated miR-24-3p target sites were synthesized using GeneArt service (Thermo Scientific). The wild type or mutated sequences were subcloned into a GFP TOPO vector (Thermo Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... a DNA fragment comprising the sgRNA target region was amplified by PCR using primers AATAGAGCAAACAACAGGAGGC and GAGTACTGACCTGGTCCTTTGG and the Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific).
-
bioRxiv - Evolutionary Biology 2022Quote: ... and the second one carrying the mutation to be introduced prepared by PCR amplification of a 6 kb region using genomic DNA of evolved clones as template and high fidelity Phusion polymerase (ThermoFisher Scientific), were co-transformed into naturally competents cells of Ralstonia evolved clones ...
-
bioRxiv - Developmental Biology 2022Quote: For FACS analysis of embryonic back skin cervical and lumbar skin regions were dissected and digested separately in Collagenase IV (Life Technologies) 4 mg/ml ...
-
bioRxiv - Plant Biology 2021Quote: ... lignin and hemicellulose bands in the fingerprint region (1800–800 cm−1) were collected using TQ Analyst EZ edition (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... The microscope was adjusted and checked for the absence of chromatic shift during fluorochrome detection from different spectral regions using the TetraSpeck Fluorescent Microspheres Size Kit (ThermoFisher Scientific). Sequential scanning mode was used for each of the four channels (DAPI ...
-
bioRxiv - Neuroscience 2022Quote: ... The target regions were amplified by PCR in a total volume of 25 µl using the Phusion Flash Mastermix (Thermo Scientific) with 2 µl genomic tail DNA ...
-
bioRxiv - Physiology 2022Quote: Brain regions were dissected on ice from 22-week-old mice and stored at −80°C in RNAlater solution (Thermo Fisher) until RNA extraction.
-
bioRxiv - Developmental Biology 2022Quote: ... The thoracic region of the spinal cord was then quickly embedded in 4% low-melting point agarose in PBS (Thermo Fisher) and 350 µm spinal cord slices were cut in ice-cold oxygenated aCSF using a vibratome (Leica VT1200) ...
-
bioRxiv - Evolutionary Biology 2022Quote: PCR products for the recombineering were designed to have 40 base overlaps with the chromosomal region necessary for recombination and were amplified using Phusion DNA polymerase (Thermo Fisher). When necessary ...
-
bioRxiv - Developmental Biology 2022Quote: The posterior part of the secondary palate (last third of the secondary palate, i.e., the region of the soft palate) was dissected into RNALater (Thermofisher Scientific, AM7020). Samples were stored at -80°C ...
-
bioRxiv - Immunology 2020Quote: ... the 5D5Δg Fab was produced by site-directed mutagenesis of the mAb 5D5 VH region using Accuprime Pfx Supermix (Thermo Fisher Scientific). 5D5Δg Fab was expressed in HEK293F cells and purified by chromatography as described above.
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Microbiology 2021Quote: ... Initially all low-quality regions and gaps were targeted with computationally selected Sanger sequencing reactions completed with 4:1 BigDye terminator: dGTP chemistry (Applied Biosystems). These automated rounds included walking on 3 kb and 8 kb plasmid subclones and fosmid clones using custom primers (400 ...
-
bioRxiv - Cell Biology 2020Quote: A TrueGuide crRNA directed against exon 1 of Hs IRS2’s coding region (target DNA sequence: 5’-TCG AGA GCG ATC ACC CGT TT −3’, Assay ID number: CRISPR850215_CR, Thermo Fisher Scientific) was annealed to the TrueGuide tracrRNA (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... The contralateral hemisphere was further microdissected under the microscope to isolate the brain region of interest on ice-cold sterile filtered PBS supplemented with 10 mM D- glucose (ThermoFisher # A2494001), snap frozen in liquid nitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR products of Cas9 and sgRNA region were used for IVT by following the manufactural of mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies) and MEGA shortscript T7 kit (Life Technologies) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Primers were designed to flank the intronic regions for the three Jheh genes (Table S1) and Phusion high fidelity DNA Polymerase (2 U/μL) (F-530XL Thermofisher Scientific) was used to amplify sequences ...
-
bioRxiv - Immunology 2021Quote: ... A CMV promoter/enhancer with an SV40 polyA was introduced into the E1 region and the spike gBlock sequences introduced by Gibson assembly (Codexis) and transformed into Stbl4 (Thermo Fisher) cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Inducible full-length Plk3 and p41Plk3 were constructed by subcloning the corresponding coding regions of Plk3 into a pENTR/D-TOPO entry vector for Gateway cloning (Life Technologies) followed by an LR recombination reaction using Gateway LR Clonase II enzyme mix (Life Technologies ...
-
bioRxiv - Bioengineering 2022Quote: The immunoprecipitated part of the library was then used for amplification of the insert region according to the manufacturer’s instructions with a Phusion Blood Direct PCR Kit (Thermo Fisher Scientific). The primers T7_Endo_Lib_LONG_FOR GCCCTCTGTGTGAATTCT and T7_Endo_Lib_LONG_REV GTCACCGACACAAGCTTA were used and a second round of PCR was carried out with the IDT for Illumina UD indexes (Illumina Corp. ...
-
bioRxiv - Plant Biology 2022Quote: ... pUQ10B::RLP4/4-L1-ECD:RFP and pUB::RLP4/4-L1ΔID:RFP were all generated by cloning the relevant gDNA region into pDONR207 (Invitrogen/Thermo Fisher Scientific) using Gateway™ BP Clonase II Enzyme Mix (Thermo Fisher Scientific ...