Labshake search
Citations for Thermo Fisher :
1501 - 1550 of 10000+ citations for 5R 3 4 5 6 Tetrahydro 5 phenyl N benzyloxycarbonyl 4 H 1 4 oxazin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... a working solution of 0.83 mg/mL solution of sulfosuccinimidyl 6-(4′-azido-2′-nitrophenylamino)hexanoate (sulfo-SANPAH, 22589; Thermo Fisher) in PBS was prepared from a stock solution of 83 mg/mL sulfo-SANPAH in DMSO (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... in blocking buffer prior to a final incubation with 4′,6-diamidino-2-phenylindole (DAPI) or anti-phalloidin for F-actin (Invitrogen) at 25 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein lysates were combined with 6× loading buffer containing 2-mercaptoethanol and loaded on NuPAGE 4%-12% Bis-Tris Midi gels (Invitrogen). After separation of protein by SDS-PAGE ...
-
bioRxiv - Cell Biology 2022Quote: ... Hoechst 43222 (H1399) and ProLong Gold Antifade Mountant with 4′,6- diamidino-2-phenylindole (DAPI; P36931) were purchased from Invitrogen.
-
bioRxiv - Cell Biology 2022Quote: ... The plates were then washed with PBS 3×10min at RT on a shaking plate and cell nuclei were stained with 20 μg/ml DAPI (4’,6-Diamidino-2-Phenylindole, Invitrogen) in PBS for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were then washed with 1xPBS and incubated with μg/ml DAPI (4’,6-diamidino-2-phenylindole; Life Technologies, #D1306). Coverslips were then mounted in Vectashield (LSBio ...
-
bioRxiv - Bioengineering 2023Quote: PAAm gels prepared on coverslips were transferred to multiwell plates before covering with 0.2 mg/mL sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino)hexanoate (sulfo-SANPAH) (Thermo Fisher) solution ...
-
bioRxiv - Physiology 2024Quote: ... CHX-treated cells were harvested at different time points (0, 2, 4 and 6 hours) and processed for immunoblotting with anti-LSD1 (Invitrogen) and anti-RCOR1 (Abcam ...
-
bioRxiv - Bioengineering 2024Quote: ... the sections were rinsed in PBS and the nuclei were counterstained and mounted with Slowfade gold antifade mountant containing 4’,6-diamidino-2-phenylindole (DAPI; #S36939, Invitrogen). The slides were imaged at a 4X magnification using EVOS M7000 (ThermoFisher Scientific™ ...
-
bioRxiv - Biophysics 2024Quote: ... This was done by placing 0.2 mg/ml sulfo-succinimidyl-6-(4-azido-2-nitrophenyl-amino) hexanoate (sulfo-SANPAH) (Thermo Fisher) in 0.5 mM pH 8.5 HEPES buffer onto the hydrogel surface and irradiating with ultraviolet (UV ...
-
bioRxiv - Bioengineering 2024Quote: ... the cells were washed three times with permeabilization buffer and counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen #D1306). The primary antibodies used included rabbit Anti-Brachyury (Abcam ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were infected in a BSL-3 lab with the UF-1 strain of SARS-CoV-2 at MOI of 4 in media containing 3% low IgG FBS (Fisher Scientific, Cat. SH30070.03).
-
bioRxiv - Plant Biology 2021Quote: ... and incubated for 1 h at 4°C with 40 μL of Protein AG UltraLink Resin (Thermo Fisher). The beads were washed 2 × 5 min in ChIP Wash Buffer 1 (0.1% SDS ...
-
bioRxiv - Plant Biology 2021Quote: ... for 1 h with gentle rotation at 4°C and then protein-G coated magnetic beads (Thermo Fisher) were added and incubated for an additional 30 min ...
-
bioRxiv - Plant Biology 2020Quote: ... and incubated for 1 h at 4°C with 40 µL of Protein AG UltraLink Resin (Thermo Scientific). The beads were washed 2 × 5 min in ChIP Wash Buffer 1 (0.1% SDS ...
-
bioRxiv - Developmental Biology 2023Quote: ... Following another 48 h of incubation at 4°C with secondary Alexa Fluor antibodies (1:100–200; Invitrogen), samples were cleared overnight in Refractive Index Matching Solution (RIMS ...
-
bioRxiv - Microbiology 2020Quote: ... washed in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Thermo Fisher Scientific, Waltham, MA, USA) two times ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by incubation with 2 μM calcein-AM and 4 μM ethidium homodimer-1 (Invitrogen) for 30 min to examine viability ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1/4 concentration of both inhibitors and is supplemented with 2% ESC-qualified FBS (Gibco). After day 2 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were blocked in 5% normal goat serum + 2% BSA and 2% Triton-X for 1 h and incubated with the following primary antibodies overnight at 4°C: rabbit anti-GFP (1:1000, Invitrogen) and chicken anti-TH (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... The lysates were incubated for 3 h at 4°C under gentle rotation with Pierce Protein G Plus Agarose (Thermo Fisher Scientific) conjugated to antibodies specific for FUS (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... reagent at a 4:2:3 ratio of sgRNA/overexpression-construct: pVSVG: psPAX2 in Opti-MEM media (Life Technologies, Thermo Fisher Scientific Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... Third instar larvae were dissected with cold HL3 and immediately fixed with PFA (4%) and incubated overnight at 4 C with primary antibodies (rabbit anti-Dlg, 1:1000; anti-Brp 1:100, Life Technologies). Alexa-conjugated secondary antibodies were used for secondary staining (Jackson Laboratories 1:500) ...
-
bioRxiv - Immunology 2023Quote: ... Drosophila S2 cells were mixed with Ramos cells or B1-8hi B cells at a ratio of 1:4 (4×105 B cells and 1×105 S2 cells) followed by total RNA extraction with TRIzol reagent (Thermo Fisher), DNaseI digestion ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Bioengineering 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass, 3 µg total plasmid) using Lipofectamine 3000 (Thermo Scientific cat. no. L3000015). Media was exchanged after 6 hours and viral supernatant was harvested 48 hours after transfection and filtered through 0.45 μm cellulose-acetate filters (VWR cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... Oligonucleotides were transfected 4 h after the plasmid using Lipofectamine™ 2000 (ThermoFisher, #11668027) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA was then reverse transcribed for 4 h using SSIV (Thermo Fisher Scientific) with a set of reverse SARS-CoV-2 primers (Supplementary Table 2) ...
-
bioRxiv - Microbiology 2022Quote: ... 4 h post transfection the medium was replaced with DMEM (Thermo Fisher Scientific, A14430) containing 0.2 % BSA ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were either left untreated or treated 4 h with HBSS media (ThermoFisher, 24020117) supplemented with 100 μM Bafilomycin (Merck ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 h prior to the experiment the cells were washed with AIMV medium (Invitrogen). The pMax_granzyme B-pHuji construct was generated by replacing the mTFP at the C-terminus of pMax-granzyme-mTFP39 with pHuji using a forward primer that included an AgeI restriction site 5′-ATG TAT ATC CAC CGG TCG CCA CCA TGG TGA GCA AGG GCG AGG AG-3′ and a reverse primer that included a NheI restriction site 5′-ATG TAT AGC TAG CTT ACT TGT ACA GCT C-3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Gibco 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (1 M) was obtained from Invitrogen (Carlsbad, CA) and sterile filtered before use ...
-
bioRxiv - Neuroscience 2020Quote: Primary cortical neurons were loaded with 2 µM Fluo-4 (Invitrogen) in KRH (Krebs’–Ringer’s–HEPES containing (in mM) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultures were loaded with 2 µM Fluo-4 AM (Thermo Fisher) in Neurobasal-A media supplemented with B27 without phenol red for 30 minutes at 37°C in a 5.5% CO2 atmosphere ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 mM MgCl2 and 2 µl of Platinum Taq polymerase (Invitrogen) with added water to a final volume of 25 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were incubated with 2 μM Fluo-4 AM (Invitrogen) diluted in HBSS solution (0.4 gL−1 KCl ...
-
bioRxiv - Neuroscience 2024Quote: ... neurons were loaded with 4 µM Fura-2 AM (Molecular Probes) for 30 min at 37°C in HBSS (consisting of in mM ...
-
bioRxiv - Biophysics 2020Quote: ... Grids were blotted for 2-4 seconds at a blotting force of 4 and plunge-frozen in liquid ethane using a MarkIV Vitrobot (Thermo Fisher Scientific). The chamber was maintained at 8 °C and 100% humidity during freezing ...
-
bioRxiv - Immunology 2020Quote: ... 2-4 × 105 cell equivalents per well were loaded into a NuPAGE 4-12% Bis-Tris density gradient gel (Thermo Fisher Scientific) and ran at a constant 150V for 80 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were loaded with the calcium indicator Fluo-4 by incubating in supplemented NB medium that contained 2 µM of Fluo-4 AM (Invitrogen, Carlsbad, CA), and Pluronic F-127 (0.04% ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Neuroscience 2023Quote: ... and 1% n-Dodecyl-β-D-maltoside were loaded onto Novex 4-16% Bis/Tris gradient gels (Life Technologies). When assaying stoichiometry of AMPAR-auxiliary subunit complexes ...
-
bioRxiv - Immunology 2024Quote: ... Membranes were stained o/n at 4°C with primary antibody rabbit chromogranin A (1:1000, Invitrogen; PA5-35071) or rabbit catestatin (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... for 2–5 h at 37°C followed by a 5 min incubation in TrypLE express (Thermo Fisher Scientific) to generate small clumps of corneal endothelial cells ...
-
bioRxiv - Microbiology 2022Quote: ... The in vitro transcription reaction for the 5’ cap driven Fluc reporter included a 1:4 ratio of Invitrogen™ Anti-Reverse Cap Analog (Fisher Scientific AM8045) and GTP solution (0.4 µl cap analog to 1.6 µl of GTP solution) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Differentiation was induced at ∼85% confluency by switching to media containing 4:1 DMEM/M199 supplemented with 5% normal horse serum (Invitrogen; cat #: 26050-088). Following seven days of differentiation cells were treated with either ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were incubated over-night at 4°C with the following primary antibodies: mouse anti-claudin-5 (Invitrogen, USA, 1:100 dilution) and rabbit anti-occludin (Invitrogen ...