Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: Nbs were diluted in a 2- or 3-fold series in Opti-MEM (Thermofisher). Each Nb dilution (110 μl ...
-
bioRxiv - Physiology 2021Quote: ... cells were fed every 2-3 days with DMEM + 10% FBS (Thermo fisher Scientific) until differentiation was complete at day 10.
-
bioRxiv - Immunology 2022Quote: ... The band are visualized with gel electrophoresis using 2-3% agarose (#16500500, Thermo Fisher) gel with SYBR Safe dye (#S33102 ...
-
bioRxiv - Neuroscience 2022Quote: ... Approximately 2-3 sections were mounted on each Superfrost Plus slide (Thermo Fisher Scientific). All sections were air-dried at −20 ° C for 1 hour and afterwards stored at −80 ° C.
-
bioRxiv - Systems Biology 2024Quote: ... Cells were passaged every 2-3 days using 0.05% Trypsin/EDTA (Gibco™, 25300062). Cell density was 5x 104 per well for the experiments in the μ-Slide (ibidi ...
-
bioRxiv - Cell Biology 2023Quote: ... MCEC were split every 2-3 days using TrypLE express enzyme (GibcoTM, Thermo Scientific) for 5min at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... use 10 μL for 2-3 ml of blood) or EDTA (0.5M EDTA, Gibco, cat ...
-
bioRxiv - Bioengineering 2024Quote: ... with media replenished every 2-3 days or passaged with TrypLE (Gibco catalog #1260421) at 60-80% confluence ...
-
bioRxiv - Bioengineering 2024Quote: ... with media replenished every 2-3 days or passaged with TrypLE (Gibco catalog #1260421).
-
bioRxiv - Molecular Biology 2024Quote: ... a 3:2 ratio of 0.5% (w/v) ORO in isopropanol (Fisher Scientific, USA): double distilled H2O (ddH2O ...
-
bioRxiv - Microbiology 2024Quote: These cell lines were subcultured every 2–3 days using 0.05% Trypsin/EDTA (Gibco). All cell lines were maintained in a humidified 37°C incubator supplied with 5% CO2.
-
bioRxiv - Bioengineering 2024Quote: ... and CellEvent™ caspase-3/7 green detection reagent (2 µM Thermo Fisher Scientific) for 1 h and then subjected to confocal microscopy imaging (Leica TCS SP8 ...
-
bioRxiv - Cancer Biology 2021Quote: ... resuspended in 2% FBS in HBSS containing 5 g/ml DAPI (Invitrogen), and sorted into DMEM containing 10% FBS ...
-
bioRxiv - Microbiology 2021Quote: ... 2% hematocrit in 1640 RPMI-HEPES supplemented with 5% AlbuMAX II (GIBCO) and 0.25% gentamycin complemented with appropriate Artemisia infusion dilutions and with or with IPP and Cm ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.5 mg of 5-ethynyl-2’ deoxyuridine (EdU) (Thermo Fisher Scientific, A10044) was injected intraperitoneally 12 h prior to euthanasia ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μl of 2 x Novex TBE-Urea Sample Buffer (ThermoFisher Scientific) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 4h and EdU (5-ethynyl-2’-deoxyuridine from Invitrogen; 10µM final) was added 1h before cells were harvested ...
-
bioRxiv - Immunology 2020Quote: ... 50 μM 2-mercaptoethanol and 5% NCTC-109 medium (Gibco, Waltham, MA). For induction of SHM ...
-
bioRxiv - Developmental Biology 2020Quote: ... mice were injected intraperitoneally with 5-ethynyl-2’-deoxyuridine (EdU; E10187; Invitrogen) at 10 mg/kg 3 hours prior to euthanasia to assay cellular proliferation.
-
bioRxiv - Physiology 2021Quote: ... The fibers were then loaded with 5 μM Fura-2 AM (Invitrogen) by incubating them for 20 min at 19°C in Tyrode’s buffer ...
-
bioRxiv - Immunology 2021Quote: ... 5 μg/mL of brefeldin A and 2 μM Monensin (both ThermoFisher) were added to each well ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were incubation with 10uM EdU (5-ethynyl-2’ -deoxyuridine) (Invitrogen, C10424) for 48hours together with either recombinant-mouse TIMP1 protein (1µg/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... embryos were incubated with 400 µM 5-ethynyl-2’-deoxyuridine (EdU) (Invitrogen)/DMSO in fish water for 1 hour at 28°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... containing 2% fetal bovine serum and 5 mM HEPES buffer (Life Technologies). For live imaging experiments ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5 μL was loaded into a 2% agarose gel (Thermo Fisher) in 1X TAE buffer (MP Biomedicals) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were pulsed with 10μM EdU (5-ethynyl-2-deoxyuridine, Invitrogen A10044) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: To detect DNA synthesis EdU (5-ethynyl-2′-deoxyuridine; 10 μM, Invitrogen) was added to the medium and incubated for 24 h from days 8 to 9 post-treatment ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 × 105 cells were resuspended in 2 μL HBSS (Gibco, Cat# 14170088) and stored on ice ...
-
bioRxiv - Immunology 2023Quote: ... cells were stained with 2 or 5 μM CellTrace Violet (Invitrogen, #C34557). For ex vivo reculture experiments ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of 5 X SYPRO orange (Life Technologies, Eugene, Oregon, USA) and 2.5 μL of the 20 mM ligand solution or the equivalent amount of buffer in the ligand-free control ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 nmoles of RNA were mixed with 5 µg yeast tRNA (Invitrogen) and SELEX buffer (SB ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 5 X SYPRO orange (Life Technologies, Eugene, Oregon, USA) and 2.5 µl of the resuspended array compounds or the equivalent amount of buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... with EdU (5-ethynyl-2’-deoxyuridine) (A10044, Invitrogen™/ Thermo Fisher Scientific) as a DPBS solution 200ug/20g body weight ...
-
bioRxiv - Cell Biology 2024Quote: ... with EdU (5-ethynyl-2’-deoxyuridine) (A10044, Invitrogen™/ Thermo Fisher Scientific) as a DPBS solution 200ug/20g body weight ...
-
bioRxiv - Biochemistry 2020Quote: ... Primary antibodies were removed by 3 washes with 2% BSA 1x PBS and incubated with 2 μg/ml anti-rabbit IgG Alexa Fluor 594 (Thermo Fisher) for 2 h in the dark at 4°C ...
-
bioRxiv - Physiology 2023Quote: ... The final plasmids for the sense and antisense expression of daf-2 or aak-2 under the str-3 promoter were generated using Gateway Cloning Technology (Life Technologies) and injected into FLP-7 secretion line (SSR1164 ...
-
bioRxiv - Immunology 2024Quote: ... and subsequently exocrine-free islets were selected and dispersed with 0.02 % trypsin for 3 min at 37 °C and washed with FACS buffer (2% FBS, 2 mM EDTA (Thermo Fisher Scientific) in PBS (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on QuantStudio 3 and 5 Real-Time PCR Systems (Thermo Fisher Scientific) based on the following cycling parameters ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM EDTA) and settled for 3 min in a magnetic stand (Fisher scientific, #FERMR02). Beads were then resuspended in 1 volume of IP buffer and ready to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grids were blotted for 3 - 5 s in a Vitrobot (Mark IV, Thermo Fisher Scientific) at 20 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were incubated with 5 pmol siRNA using lipofectamine RNAiMAX (Thermo Fisher) in a 12-well tissue culture plate for 2hr ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were then washed 3 times for 5 minutes with 1X DPBS (14080055, Gibco) containing 0.1% Tween ...
-
bioRxiv - Microbiology 2023Quote: ... FungiQuant-Prb (6FAM) 5′-TGGTGCATGGCCGTT-3′ (MGBNFQ) 57 and QuantStudio3 instrument (Applied Biosystems, CA, USA). We used the following qPCR conditions ...
-
bioRxiv - Bioengineering 2024Quote: ... Red blood cells were lysed with ACK Lysing Buffer (Gibco, 3 ml for 5 min). The cells were counted and resuspended in RPMI-1640 medium (Corning ...
-
bioRxiv - Molecular Biology 2024Quote: ... Add pre-mix chewing solution (5 μl 10xNEBbuffer2.1, 3 μl 100 mM DTT (ThermoFisher, A39255), 2 μl 100 mM ATP (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... homogenized and placed in sterile 5 mL Eppendorf tubes containing 3 mL of RNAlater (ThermoFisher). The tubes were stored at -20°C upon our arrival in the laboratory ...