Labshake search
Citations for Thermo Fisher :
1351 - 1400 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... cells were loaded with 5 µM of Fluo-4-AM (Thermo Fisher Scientific) or for 50 min at room temperature in the dark ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4-5 mg/mL of Ellman’s reagent (Thermo Fisher Scientific, Waltham, MA) were dissolved in a sodium phosphate buffer (0.1M NaH2PO4 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were split every 4-5 days with TrypLE Select Enzyme (Life Technologies) as previously described ...
-
bioRxiv - Genomics 2020Quote: ... Abl.3 and Abl.4 (13) were cultured in Roswell Park Memorial Institute medium (Gibco), containing 15% FBS (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: HAEC cells (passage 3-4) were lysed in ice-cold RIPA buffer (ThermoFisher, cat# 89900) containing protease and phosphatase inhibitors (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell number was determined every 3-4 days using the Countess automated cell counter (Invitrogen). 20,000 cells were then re-plated with fresh media and compound ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was isolated from approximately 3-4 x 107 cells using TRIzol reagent (Thermo Fisher), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... for 3-4 hr in the presence of brefeldin A (BFA; 10ug/mL; Life Technologies).
-
bioRxiv - Neuroscience 2022Quote: Hippocampal neurons were transfected at day in vitro (DIV)3-4 using Lipofectamine 2000 (Invitrogen). Shortly ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3-4 μm paraffin sections were prepared with a HM 355S microtome (Fisher Scientific, 10862110), deparaffinized and rehydrated up to 96% ethanol (v/v) ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 3-4 days before they were collected directly in TRIzol reagent (Invitrogen cat#15596026). Before collection ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by a second round of transfection 3-4 hours later using RNAiMax (Life Technologies) according to the manufacturer’s instructions with final siRNA concentration of 50 nM and 20 nM for Sac2 and OSBP ...
-
bioRxiv - Immunology 2023Quote: ... Cell passaging was performed every 3 to 4 days using 0.05% Trypsin-EDTA solution (Gibco). Expi293F cells were maintained in Expi293 Expression Medium (Thermo Fisher Scientific) ...
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).
-
bioRxiv - Biochemistry 2024Quote: ... Half of the culture medium was refreshed every 3-4 days with DMEM (Gibco, USA) supplemented with 10% FBS (CellMAX ...
-
bioRxiv - Biochemistry 2024Quote: ... 4°C) and resolved (~80 μg/lane) in a linear 3-12% acrylamide gradient (Invitrogen). For BN-PAGE ...
-
bioRxiv - Biophysics 2024Quote: ... The Ca2+-sensitive dyes Fluo-4 AM (Dojindo) and Rhod-3 AM (Thermo Fisher Scientific) were employed ...
-
bioRxiv - Microbiology 2022Quote: ... PAFB was labelled with the green fluorophore 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-propionyl ethylenediamine hydrochloride (BODIPY™ FL EDA, Invitrogen, Waltham, MA, USA) as described (32).
-
bioRxiv - Genetics 2022Quote: ... The styryl dye N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM4-64, 514/670 nm absorption/emission Invitrogen™, Waltham, Massachusetts) was used at a final concentration of 16.5 μM in ddH2O from a 16.5 mM stock solution in DMSO ...
-
bioRxiv - Neuroscience 2021Quote: ... The brains were then washed in PBST-2 (PBS containing 0.1% Triton X-100) for 3 x 2 mins and blocked with SeaBlock blocking buffer (Thermo Fisher) for 15 mins at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... particle size = 3 μm, C18, L = 2 cm; analytical column: particle size = 2 μm, C18, L = 50 cm; PepMap, Dionex/Thermofisher). Peptides eluting from the column were ionized using an Orbitrap Elite (Thermofisher).
-
bioRxiv - Cell Biology 2020Quote: ... media was changed gradually into a gradient of (1/4) Neurobasal media (NB: based medium contained 1% Lglutamine, 1% N2 and 2% B27 (all from Invitrogen)) plus reduced gradient of (3/4 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... then incubated at 37C for 5 min in 2 ml M3+BPYE media containing 1 ml Turbo DNase (2 U/μL) (ThermoFisher cat. no. AM2239) per 36 ml ...
-
bioRxiv - Cell Biology 2021Quote: ... the media was replaced entirely with fresh retinal differentiation media (RDM) (DMEM:F12 3:1, 2% B27 supplement, MEM NEAA, 1× antibiotic, antimycotic (Thermo Fisher) and 1× GlutaMAX)) ...
-
bioRxiv - Cell Biology 2020Quote: ... the media was changed to retinal differentiation medium (RDM;DMEM:F12 3:1, 2% B27 supplement, MEM NEAA, 1× antibiotic, antimycotic (Thermo Fisher) and 1× GlutaMAX) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Buffy coat was mixed 1:2 with PBS and added onto a Ficoll gradient in a 3:1 ratio (Invitrogen). This was centrifuged at 2100 rpm for 25 minutes at RT (w/o brakes) ...
-
bioRxiv - Microbiology 2024Quote: ... the PBS or virus dilution in PBS was aspirated and 3 ml of overlay consisting of 1:1 2 x DMEM (DMEM high glucose, no sodium bicarbonate buffer powder [Gibco # 12-100-046] in 500 mL of RNase-free water ...
-
bioRxiv - Microbiology 2020Quote: ... we used 15 μL of a mixture of 4’,6-diamidin-2-phenylindole (4 μg mL−1) in SlowFade Gold Antifade Mounting medium (both Thermo Fisher Scientific, Waltham, MA, USA). All solutions and buffers for virus-targeted genomeFISH experiments were prepared with molecular grade water (Carl Roth ...
-
bioRxiv - Cancer Biology 2023Quote: ... KIF18A siRNAs used were a 1:1 mixture of two the following Silencer or Silencer Select Validated siRNAs (5’ to 3’ sequence): GCUGGAUUUCAUAAAGUGGtt (Ambion, AM51334), GCUUGUUCCAGAAUCGAGAtt (Ambion ...
-
bioRxiv - Cell Biology 2023Quote: ... KIF18A siRNA used was a 1:1 mixture of the following two Silencer Select Validated siRNAs (5’ to 3’ sequence): GCUGGAUUUCAUAAAGUGGtt (Ambion, AM51334) CGUUAACUGCAGACGUAAAtt (Ambion ...
-
bioRxiv - Neuroscience 2024Quote: ... Two-phase extraction was performed by adding 400 µl of methyl-tert-butyl ether (MTBE): methanol (3:1, v/v; all solvents of High-performance liquid chromatography (HPLC)-grade (Thermo Fisher Scientific, Germany)) ...
-
bioRxiv - Neuroscience 2020Quote: ... The water contained 1 mg/mL 5-ethynyl-2-deoxyuridine (EdU) (Thermo Fisher Scientific, Cat. # E10187) and 1% sucrose ...
-
bioRxiv - Physiology 2021Quote: ... 1-2 µg of vector DNA was mixed with 5 µl of Lipofectamine™ (Thermo Fisher) in OPTIMEM-I media (GIBCO ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were loaded with Fura-2 AM at 1 μg/mL (108964-32-5, Life Technologies) in HBSS or Fluo-4 AM at 10 μM in (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... 2-5×106 cells were incubated in 15 μl Indo-1 solution in 1ml IMDM (Gibco) + 1%FBS (Sigma ...
-
bioRxiv - Biophysics 2024Quote: ... and 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydro (EDC, ThermoFisher). For BS3 crosslinking ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mix 1 contains 3 siRNAs (CliniSciences, CRH7929) and Mix 2 contains two siRNAs (ThermoFisher Scientific, 1299001 and 4392420). As a negative control ...
-
bioRxiv - Microbiology 2021Quote: ... A recombinant lentivirus vector expressing the coding sequence of the EBV transactivator BZLF1 under control of a tetracycline-regulated promoter was constructed by cloning the open reading frame amplified with the primers 5’-CGACCGGTATGATGGACCCAAACTCGAC-3’ and 5’-CGACGCGTTTAGAAATTTAA GAGATCCTCGTGT-3’ into the Age I and Mlu I sites of the pTRIPZ lentiviral vector (Thermo Fisher Scientific, USA). For virus production ...
-
bioRxiv - Microbiology 2020Quote: ... and probe E_Sarbeco_P1 (5′-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ-3′) using the TaqPath 1-Step Multiplex Master Mix kit (Applied Biosystems) on a QuantStudio 5 real-time PCR system (Appiled Biosystems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.125 μM Oligo-dT30VN (IDT, 5’AGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Neuroscience 2021Quote: ... slides were washed in 3×5’ PBS and incubated in goat-α-rabbit-555 (1:1000, Life Technologies, A21207) in PBS for 90’ ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were washed in 0.1 M TB (3 ×5 minutes) and then incubated in goat anti-chicken Alexa 488 (1:1000, #A11039, Invitrogen), goat anti-rabbit Alexa 568 (1:500 to 1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... Following preset incubation times (0, 0.5, 1, 3, or 5 h) cells were harvested by trypsinization (500 μl TrypLE, Gibco) for 5 min at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3.125 µM Oligo-dT30VN (IDT, 5′-AAGCAGTGGTATCAACGCAGAGTACT30VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Neuroscience 2024Quote: ... animals were incubated for 5 min in TO-PRO-3 Iodide (642/661) (Invitrogen, cat#T3605, 1:1000 dilution). And last ...
-
bioRxiv - Neuroscience 2024Quote: ... washed 3 x 5 min in PBS at RT and then incubated with Hoechst 33342 (1:5000, Invitrogen, H3570) in PBS for 30 min at RT ...
-
bioRxiv - Pathology 2023Quote: ... were incubated with 10 µM red fluorescent Lipophilic Tracer DiD (1,1’-dioctadecyl-3, 3, 39, 39-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt; Thermo Fisher Scientific, Waltham, MA, USA) and/or 2 mM SYTO RNA-Select Green Fluorescent Cell Stain Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were centrifuged at 14,000g for 5 minutes at 4°C and electrophoresed on NuPAGE™ 4-12% Bis-Tris Polyacrylamide gels (Thermo Fisher) with NuPAGE™ MOPS running buffer (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... (4) 30 min incubation in ammonium chloride (NH4Cl) and (5) 4 min incubation in Tissue Autofluorescence Quenching Kit (ReadyProbes, ThermoFisher Scientific).Secondary antibodies were used as follows ...