Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for Leucine Rich Repeats And Immunoglobulin Like Domains Protein 3 LRIG3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and 40 µg of antibody was bound to 3 mg of protein G Dynabeads (Thermo Fisher Scientific) in 400 µL of PBS buffer containing 0.2% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Soluble material was incubated with 3 μg of antibody bound to 50 μl protein A Dynabeads (Invitrogen) and incubated overnight at 4 °C ...
-
bioRxiv - Immunology 2021Quote: DNA constructs encoding anti-SCARB2 antibody heavy and light chain variable domains (clone JL278) were synthesized (ThermoFisher) and cloned into mammalian expression vectors containing a mouse IGHV signal peptide and IgG1 constant regions ...
-
bioRxiv - Biochemistry 2022Quote: ... Proliferation assays using Human Plasma-Like Medium (HPLM) (ThermoFisher, A4899101) were supplemented with 10% dialyzed FBS ...
-
bioRxiv - Microbiology 2023Quote: ... ISG MX dynamin-like GTPase 1 (Mx1, Thermo Fisher, Mm00487796_m1) expression was assessed in select samples ...
-
bioRxiv - Microbiology 2022Quote: ... Human Plasma-Like Media (HPLM, Thermo Fisher Scientific, Waltham, MA) was used without added HEPES or exogenous hypoxanthine ...
-
bioRxiv - Systems Biology 2019Quote: ... DMEM minus leucine was constituted by supplementing DMEM-LM (Cat No. 30030 Thermo Fisher), which lacks L-leucine and L-methionine ...
-
bioRxiv - Pathology 2020Quote: ... incubated for 30 min at room temperature (RT) with 1:500-diluted (in PBS) Alexa Fluor 594-labeled goat anti-rabbit immunoglobulin secondary antibody (Invitrogen) and then washed four times with PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... the cells were incubated with Alexa-594 coupled goat anti-rabbit immunoglobulin G (IgG) secondary antibodies (1:5000; Molecular Probes) in 1x PBS for 2 hours at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... for HCN4 and/or Alexa Fluor 633–conjugated donkey antibodies to goat immunoglobulin G (#A-21082, Invitrogen; diluted 1:200) for TNNI3 ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 2.5 g/L Albumax I Lipid-Rich BSA (Thermo Fisher 11020039), 15 mg/L hypoxanthine (Sigma H9636) ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 2.5 g/L Albumax I Lipid-Rich BSA (Thermo Fisher 11020039), 15 mg/L hypoxanthine (Sigma H9636) ...
-
bioRxiv - Genetics 2020Quote: ... PCR was performed using AccuPrime GC-Rich DNA Polymerase (Invitrogen, Carlsbad, CA, USA). PCR was performed following the manufacturer’s instructions with the annealing temperature of 61°C and 35 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 2.5 g/L Albumax I Lipid-Rich BSA (Thermo Fisher 11020039), 15 mg/L hypoxanthine (Sigma H9636) ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 205 g/L AlbuMAX I Lipid-Rich BSA (Thermo Fisher 11020039), 15 mg/L hypoxanthine (Sigma H9636) ...
-
bioRxiv - Cell Biology 2022Quote: ... HRP-conjugated Goat anti-mouse immunoglobulins (G-21040, ThermoFisher Scientific) diluted 1:100,000 in PBS containing 0.05% Tween 20 and 3% BSA were applied for 1 h ...
-
bioRxiv - Immunology 2019Quote: ... Lysates were immunoprecipitated with control mouse immunoglobulin G (IgG) (Invitrogen) or anti-Flag antibody (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... Lysates were immunoprecipitated with control mouse immunoglobulin G (IgG) (Invitrogen) or anti-Flag antibody (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: Expression and purification of secreted SIDT1 and SIDT2 extracellular domain The SIDT1ECD and SIDT2ECD proteins were expressed using FreeStyle 293-F cells (Invitrogen). The cells were cultured in OPM-293 CD05 medium (OPM Biosciences co. ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Centromeric repeat probes were amplified by PCR using Biotin-11-dUTP (Thermofisher) with primer TCTAGCACTTGTAATCAATCAAATTC and AGAAGTGAGAAGAAAGACTTG ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was extracted from each repeat using Trizol (Life Technologies, Invitrogen) and DNA was removed by RQ1 DNase (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was extracted from each repeat using Trizol (Life Technologies, Invitrogen) and DNA was removed by RQ1 DNase (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from each repeat using Trizol (Life Technologies, Invitrogen) and DNA was removed by RQ1 DNase (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from each repeat using Trizol (Life Technologies, Invitrogen) and DNA was removed by RQ1 DNase (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... 42Q and 63Q repeats (GenBank Accession #: MK291497-MK291499) were synthesized (Life Technologies) by adding XbaI and SacI restriction enzyme cutting sites at the 5’ and 3’ ends of each DNA sequence for sub-cloning ...
-
bioRxiv - Biophysics 2020Quote: Wild-type PSD-95 PDZ3-SH3-GK (PSG), PDZ3 domain and mutants (all pseudo, engineered F337W in PDZ3 domains) are encoded in modified pRSET vector (Invitrogen) and transformed in Escherihia coli BL21(DE3 ...
-
bioRxiv - Immunology 2021Quote: The COVID-19 receptor-binding domain (RBD) and the N-terminal peptidase domain of human ACE2 were expressed using HEK293F cells (Invitrogen). The COVID-19 RBD (residues Arg319-Phe541 ...
-
bioRxiv - Developmental Biology 2020Quote: ... A pMA-T vector encoding for a DNA in which the DSG domain of Arpp19 sequence was exchanged by the cassette domain (D2-D1 mutant) was synthesized by Geneart (Thermofisher) and sub-cloned into Pet-15 6his vector.
-
bioRxiv - Immunology 2021Quote: ... The immunoglobulin kappa-only and dual-gene (immunoglobulin kappa and immunoglobulin gamma) plasmids were transfected at a 2:1 molar ratio into ExpiCHO cells using ExpiFectamine (Thermo Fisher Scientific, Waltham, MA, USA). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... (3) protein A magnetic dynabeads (Thermo Fisher Scientific) were used ...
-
bioRxiv - Immunology 2023Quote: ... 3 μL HiFi Cas9 protein (61 μM; Invitrogen) was mixed with 2 μL Buffer R for each reaction (Neon Transfection System Kit ...
-
bioRxiv - Immunology 2022Quote: ... AD-2 domain site 1 (Life Technologies Corporation), Domain I ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... Antibodies: Galectin 3 (Invitrogen MA1-940), Galectin 9 (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: BMEC-like cells were lysed with RIPA buffer (Thermo Fisher Scientific) supplemented with protease inhibitor (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: Neutrophil-like HL60 cells were maintained in RPMI media (Gibco 22400), supplemented with 10% heat-inactivated fetal bovine serum (hiFBS ...
-
bioRxiv - Immunology 2023Quote: ... Foxp3+ Treg-like cells and iTregs were by TRIzol reagent (Invitrogen). The RNA library was generated using the NEB Ultra II Directional RNA Library Prep Kit and quantified using Qubit Bioanalyzer ...
-
bioRxiv - Immunology 2023Quote: RAW264.7 macrophage-like cell line was cultured in RPMI medium (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... Cell associated immunoglobulin was detected with an appropriate FITC-labelled secondary antibody and fluorescence measured using an Attune NXT cytometer (Thermofisher, UK). Data are shown as relative fluorescence intensities calculated as a percentage of the negative control fluorescence.
-
bioRxiv - Systems Biology 2022Quote: ... Immune complexes were detected with Alexa Fluor Plus 488–conjugated goat antibodies to rabbit immunoglobulin G (Invitrogen–ThermoFisher Scientific, Cat# A32731). Nuclei were stained with Hoechst 33342 (Invitrogen) ...
-
bioRxiv - Systems Biology 2022Quote: ... Immune complexes were detected with Alexa Fluor Plus 488–conjugated goat antibodies to rabbit immunoglobulin G (Invitrogen–ThermoFisher Scientific, Cat# A32731). Nuclei were stained with Hoechst 33342 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Horseradish peroxidase– conjugated secondary antibodies, goat anti-mouse immunoglobulin G (IgG) (# 32230), and goat anti-rabbit IgG (# 32260, 1:5000) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were washed three times in PB and incubated at room temperature with the secondary antibody to rabbit immunoglobulins (rabbit, Alexa Fluor-488, A21206, 1:600, Life Technologies) in NDS-T-PB for 2 h at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were incubated for 1 h at RT with the secondary antibodies: goat anti-rabbit immunoglobulin G (IgG) Alexa Fluor 488 and/or goat anti-mouse IgG Alexa Fluor 594 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... analysis using a WD repeat-containing protein on Y chromosome (WDY)- and Rp49-specific primer mix by ampliTaq Gold 360 master mix (Applied Biosystems, Foster City, CA, USA), and then the amplified DNA fragments were separated by 2% agarose gel electrophoresis (S1 Fig).
-
bioRxiv - Genomics 2019Quote: ... Proteins were separated on NuPAGE 3-8% Tris-Acetate Protein Gels (Thermo Fisher). The primary antibodies used were mouse anti-CAS9 (7A9-3A3 ...
-
bioRxiv - Biophysics 2022Quote: ... 28,32 Concentration of TALI(23-I23)’s MOTH domain was determined using the Pierce™ BCA Protein Assay Kit (Thermo Scientific).
-
bioRxiv - Microbiology 2020Quote: One 96-well plate was coated with 200ng/well of recombinant N protein and another plate was coated with 200ng/well of recombinant 6xHis-tagged SARS-CoV-2 spike protein receptor binding domain (RBD) produced using the FreeStyle 293 Expression System (Thermo Fisher) from BEI Resources (Cat# NR-52366 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The 6X His tagged extracellular domain of hPD-L1 WT or 2HA proteins were expressed in the ExpiCHO cell system (ThermoFisher Scientific) and purified by the Ni-NTA agarose (ThermoFisher Scientific ...
-
bioRxiv - Synthetic Biology 2021Quote: ... we used a rich variant of M9-glycerol media containing M9 salt (Fisher Scientific), 4 % ultrapure glycerol (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 50 μg/mL neutralized rat tail collagen (rich in Coll I) (Gibco, A1048301) for 2 hours to overnight at 37 °C ...