Labshake search
Citations for Thermo Fisher :
101 - 150 of 8398 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... control siRNAs and two individual FOXM1 siRNAs were transfected (40nM f.c. siRNA) using RNAiMAX (Thermo Fisher Scientific) 24 hours before collecting cells and seeding them into low-attachment plates ...
-
bioRxiv - Cell Biology 2020Quote: ... A non-targeting scrambled siRNA (Silencer negative control siRNA, Ambion) was used as a control.
-
bioRxiv - Immunology 2021Quote: ... The siRNAs targeting DDX18 or the negative control siRNA (Invitrogen) were transfected at a working concentration of 50 nM ...
-
bioRxiv - Physiology 2020Quote: ... or control siRNA (non-targeting negative control siRNA; Invitrogen, 4390843) at 10 nmol/L ...
-
bioRxiv - Cell Biology 2020Quote: The following siRNAs were used: Silencer Select siRNA (Life Technologies) against CEP57 (s18692) ...
-
bioRxiv - Neuroscience 2021Quote: All siRNA were purchased from Accell smartpool siRNA (Thermo Scientific), following the manufacturers protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The control siRNA and a pool of TAX1BP1 siRNA (Ambion) were used for TAX1BP1 silencing experiments.
-
bioRxiv - Molecular Biology 2022Quote: ... or custom siRNAs targeting S1P (Silencer Select siRNAs, Life Technologies) using Lipofectamine RNAiMAX as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNAs used in this study are: RBM10 siRNA #1 (ThermoFisher Scientific HSS112075 ...
-
bioRxiv - Neuroscience 2023Quote: All siRNA were purchased from Accell smartpool siRNA (Thermo Scientific), following the manufacturers protocol ...
-
bioRxiv - Genomics 2023Quote: The following siRNAs were used: Silencer Select siRNA (Life Technologies) against POLQ no.1 (s21059) ...
-
bioRxiv - Cancer Biology 2023Quote: siRNA products were purchased from Thermo Fisher (Silencer Select siRNA). The specific products used were ...
-
bioRxiv - Cancer Biology 2021Quote: ... The silencer select siRNA targeting human ERK3 and the Silencer non-targeting Control #1 were purchased from Ambion.
-
bioRxiv - Cell Biology 2021Quote: ... RNA interference was performed using 10 pmol of duplexes targeting human MLKL (GCAACGCAUGCCUGUUUCACCCAUA, Stealth siRNA from Life Technologies) or non-silencing control duplexes (low-GC 12935111 ...
-
bioRxiv - Microbiology 2022Quote: THP-1 cells (1.0 × 106) were transfected with human siRNA (10 nM) using Lipofectamine 3000 (Invitrogen, Waltham, MA). All siRNAs were ON-TARGETplus SMARTpool (Dharmacon ...
-
bioRxiv - Cell Biology 2022Quote: Two separate human ASAH1-siRNAs (50 nM) (Dharmacon,) were transfected into 621-101 cells using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2021Quote: ... siRNAs from Ambion were used for A1S (siRNA ID ...
-
bioRxiv - Molecular Biology 2020Quote: ... and siRNAs (Invitrogen) (sequences provided in Supplemental Table 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA scrambled: (Ambion), siRNA HIF-1α (target sequence ...
-
bioRxiv - Neuroscience 2021Quote: ... siRNA(−) (ThermoFisher Scientific). For transfection ...
-
bioRxiv - Biophysics 2021Quote: Stealth siRNA (Invitrogen) targeting IRSp53 (BA-IAP2 ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA SRSF7 (Invitrogen) or a negative scrambled control (IDT) ...
-
bioRxiv - Cell Biology 2020Quote: ... control siRNA (Ambion). Expression plasmids were transfected in HeLa and YFP-Parkin HeLa using Xtreme Gene 9 (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA oligos (Ambion, Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... siRNAs from Ambion were used (catalog no ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNAs (Thermo Fisher) used include ...
-
bioRxiv - Cancer Biology 2023Quote: ... siRNAs from Ambion Life Technologies were as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... or experimental siRNAs (single siRNAs or siRNA pools – see Key Resources) using the standard Lipofectamine 2000 (Invitrogen, 11668027) manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: The scrambled siRNA or the specific VEGFR siRNA (VEGFR-1-VEGFR-2 siRNA, Ambion Life Technologies, Monza, Italy) were intrathecally (i.t. ...
-
bioRxiv - Neuroscience 2021Quote: The scrambled siRNA or the specific VEGFR siRNA (VEGFR-1-VEGFR-2 siRNA, Ambion Life Technologies, Monza, Italy) were intrathecally (i.t. ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA oligos (Ambion, Life Technologies; siRNA ID #s s18158 and s18160) were transfected with Lipofectamine 3000 twice ...
-
bioRxiv - Cell Biology 2021Quote: ... 300 nM Slc37a2 siRNAs or Silencer™ negative control siRNA (Ambion) was added to the solution ...
-
bioRxiv - Cancer Biology 2020Quote: ... ERO1lα siRNA (HSS121196) or non-targeted control (NTC) siRNA (Thermofisher Scientific) were transfected using the lipofectamine RNAiMAX reverse transfection method (Thermofisher Sientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The siRNA knockdown screen used custom libraries (siRNA Silencer Select, ThermoFisher) targeting proteins that localize to the nuclear membrane (346 genes ...
-
bioRxiv - Genetics 2021Quote: ... or two different siRNAs targeting OAS1 (siRNA-1 or −2, Ambion). The siRNA-1 and −2 were selected with an efficiency of 70-95% for OAS1 knockdown in h-iPSC-Mg ...
-
bioRxiv - Biochemistry 2021Quote: ... PEX3 siRNA (sequence GGGAGGAUCUGAAGAUAAUAAGUUUuu) and MMGT1 (EMC5) siRNA (ThermoFisher Scientific, s41129). 850,000 cells were plated in a 10-cm dish ...
-
bioRxiv - Molecular Biology 2021Quote: ... All siRNAs were Ambion Silencer Select Pre-designed siRNAs (Life Technologies) with the following ID# ...
-
bioRxiv - Molecular Biology 2022Quote: ... or a custom siRNA targeting S1P (Silencer Select siRNAs, Life Technologies) with empty vector (pCMV6-Entry ...
-
bioRxiv - Microbiology 2023Quote: ... DOT1L siRNA (AM16708) and scrambled siRNA were procured from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... siRNA scrambled (siRNAscr; Silencer R Negative Control siRNA #1, AM4635, Ambion) in Opti-MEM medium with Lipofectamine RNAiMax (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... An siRNA solution was made up for each siRNA (1.4μL 100uM siRNA [Horizon Discovery, UK] + 350μL OptiMEM [Gibco, Massachusetts, US]) and a lipofectamine solution (3μL Lipofectamine 2000 [Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stealth RNAiTM siRNAs Negative Control, Med GC and human Il11, NM_000641.3 (HSS179893, HSS179894, HSS179895) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2020Quote: ... For RHBDL4 and OST4 depletion 50 pmol (RHBDL4) or 25 pmol (OST4) ON-TARGETplus SMARTpool human siRNA (Dharmacon) and 2.5 μl RNAimax (Invitrogen) transfection reagent per well of a 12-well plate were used ...
-
bioRxiv - Genetics 2021Quote: ... with 12.5 pmol of either non-targeting negative control siRNA showing no homology to the human transcriptome (#4457287, Ambion), or two different siRNAs targeting OAS1 (siRNA-1 or −2 ...
-
bioRxiv - Cell Biology 2023Quote: ... and separately two Silencer Select siRNAs targeting human Myosin ID (4392420; ID s9203 and s9204; Invitrogen, Thermo Fisher Scientific) at a final concentration of 0.01 uM using Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and separately two Silencer Select siRNAs targeting human Myosin ID (4392420; ID s9203 and s9204; Invitrogen, Thermo Fisher Scientific) at a final concentration of 0.01 uM using Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... and/or ALK1 (SMARTpool ON-TARGETplus Human ACVRL1 siRNA, Dharmacon L-005302-02-0005) using Lipofectamine 3000 (ThermoFisher L3000015) according to manufacturer directions ...
-
bioRxiv - Developmental Biology 2024Quote: ... siRNAs were transfected into human chondrocytes obtained from articular cartilage using Lipofectamine™ RNAiMAX Transfection Reagent (Thermo Fisher Scientific). After treatment with siRNA for 1 week ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were grown in 24 -well plates to ∼60% confluency and transfected with small interfering RNA specific to TRPM2 (TRPM2-siRNA, 5′-GAAAGAAUGCGUGUAUUUUGUAA-3′, custom-made by Dharmacon) or scrambled control siRNA (Scr-siRNA: 4390846, Ambion) in Opti-MEMTM using 25 nM siRNA and 1 ul of Lipofectamine® RNAiMAX28 ...