Labshake search
Citations for Thermo Fisher :
351 - 400 of 8398 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... three Silencer® Select siRNA oligos specifically targeting YWHAB (Thermo Fisher, siRNA ID: s14961, s14962, s14963) were used ...
-
bioRxiv - Molecular Biology 2024Quote: ... BMDMs were transfected with nontargeting control siRNA and siRNA-hdac6 using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and SK-N-AS cells were transfected with 150pM of siRNA (Silencer Select siRNAs, ThermoFisher Scientific) using RNAiMAX lipofectamine reagent (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... siRNA knockdown using the D’harmacon siGENOMETM siRNA pool were transfected for 24 h using RNAiMAX (Invitrogen) according to manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... or scrambled siRNA (Ambion™ In Vivo Negative Control #1 siRNA Invitrogen™, Thermo Fisher Scientific) were mixed with 0.6 μl in vivo-jetPEI® transfection reagent (in vivo-jetPEI® ...
-
bioRxiv - Immunology 2024Quote: ... or scrambled siRNA (Ambion™ In Vivo Negative Control #1 siRNA Invitrogen™, Thermo Fisher Scientific) were mixed with 0.6 μl in vivo-jetPEI® transfection reagent (in vivo-jetPEI® ...
-
bioRxiv - Developmental Biology 2024Quote: siRNA for DNMT1 and scrambled siRNA for as a negative control were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... siRNAs were obtained from Thermo Fisher: Non-specific siRNA (4390844) ...
-
bioRxiv - Cell Biology 2020Quote: ... QPRT siRNA was purchased from ThermoFisher, and the IDO siRNA referred was as described (34) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Pre-designed silencer select siRNA (Ambion) are ordered for SRRM2 (ID ...
-
bioRxiv - Cell Biology 2022Quote: Stealth RNAi siRNAs (Thermo Fisher Scientific) were used for RNA interference ...
-
bioRxiv - Microbiology 2021Quote: ... siRNA from Ambion (catalog no. 4390824) was used ...
-
bioRxiv - Bioengineering 2020Quote: ... The following Stealth Select siRNAs (Invitrogen) were used in this study ...
-
bioRxiv - Biochemistry 2020Quote: ATP1A3 siRNA (s1724, Thermo Fisher Scientific) was mixed with Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: Limk1 siRNA (s134717, Thermo Fisher Scientific), GW182 siRNA (s107649 ...
-
bioRxiv - Neuroscience 2021Quote: ... siRNAs were diluted in Optimem (Gibco) and mixed with siLentFect Lipid Reagent (Bio-Rad Laboratories) ...
-
bioRxiv - Cancer Biology 2020Quote: siRNAs were purchased from Thermo Scientific (see Supplementary Table for list of specific siRNAs) ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNA was diluted in OptiMem (Gibco) to a final working concentration of 25 pmol siRNA per well of a 6-well plate ...
-
bioRxiv - Cell Biology 2021Quote: ... DharmaFECT siRNA transfection reagent (Fisher scientific) without antibiotics ...
-
bioRxiv - Genomics 2021Quote: ... NR4A3 Silencer Select siRNA (Applied Biosystems - Thermo Fisher Scientific Japan ...
-
bioRxiv - Microbiology 2021Quote: ... siRNA using Lipofectamine RNAiMAX (Invitrogen; #13778150) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: siRNA transfections using Lipofectamine RNAiMAX (Invitrogen) were performed according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and FOXO3a siRNA from Thermo Scientific Dharmacon.
-
bioRxiv - Cancer Biology 2020Quote: ... or scramble siRNA using RNAiMAX (Invitrogen). Transfected cells were treated with PG3-Oc ...
-
bioRxiv - Cell Biology 2021Quote: ... All siRNAs were obtained from Ambion: murine Fmr1 (Ambion ...
-
bioRxiv - Cell Biology 2021Quote: ... Non-targeting siRNA pool (Thermo Scientific) was used as control.
-
bioRxiv - Cell Biology 2021Quote: ... Silencer Negative Control siRNA #1 (Invitrogen) was used as negative control for Real Time qPCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... PLK1 (Silencer Select siRNA #1, Ambion) as positive control ...
-
bioRxiv - Cell Biology 2021Quote: All siRNAs used were from Ambion and are described in Table 1 ...
-
bioRxiv - Cancer Biology 2022Quote: Silencer® Select siRNAs (s8392, Invitrogen) targeting Mad2 (gene name MAD2L1 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 siRNA (cat# AM4611 Thermofisher Scientific) was used as a control ...
-
bioRxiv - Bioengineering 2022Quote: ... The following Stealth Select siRNAs (Invitrogen) were used in this study ...
-
bioRxiv - Pathology 2022Quote: ... and negative control siRNA (#4390843, Ambion Silencer Select Negative Control No ...
-
bioRxiv - Cell Biology 2022Quote: ... We utilized siRNA (Thermo Fisher Scientific) synthesized to knockdown human GJA1 mRNA (sequence 5’ to 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... siRNA and Lipofectamine RNAiMAX (Life Technologies) were combined and incubated in OptiMEM for 5 min at room temperature before being added to cells ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA was transfected using RNAimax (Invitrogen) transfection reagent according to manufacturer recommendation ...
-
bioRxiv - Microbiology 2020Quote: ... siRNAs included NLRP3 (Ambion, Cat. s41554), NEK7 (Ambion ...
-
bioRxiv - Cancer Biology 2020Quote: ... and or scrambled siRNA (Ambion, #AM4635). After transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were transfected using RNAiMAX (Invitrogen).
-
bioRxiv - Neuroscience 2022Quote: ... siRNA oligonucleotides were synthesized by Invitrogen, USA ...
-
bioRxiv - Microbiology 2022Quote: All siRNAs were obtained from Invitrogen. 293T cells (1-1.5 x 105 cells/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... Scrambled (control) siRNA was from ThermoFisher. siRNAs were transfected into cells using Lipofectamine-2000 ...
-
bioRxiv - Biophysics 2020Quote: ... All siRNAs were purchased from Ambion® (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... and siRNA scramble controls (AM4621, Thermofisher). siRNAs were transfected using Lipofectamine-RNAiMAX (13778100 ...
-
bioRxiv - Physiology 2020Quote: ... control siRNA (Ambion, Austin, TX, USA) were used to knockdown 14-3-3ζ ...
-
Loss of p32 triggers energy deficiency and impairs goblet cell differentiation in ulcerative colitisbioRxiv - Molecular Biology 2020Quote: ... or control siRNA (Thermo Fisher Scientific) by reverse lipofection using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2021Quote: All siRNAs are from Thermo Fisher Scientific with the specific Assay IDs as follows ...
-
bioRxiv - Cancer Biology 2021Quote: ... silencer select negative siRNA (4390843, Ambion) was used as transfection control.
-
bioRxiv - Cell Biology 2020Quote: ... siRNAs were transfected using RNAiMAX (Invitrogen), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... rabaptin5 siRNA (5’CCGGGCAAUUCUGAAUGAUACUAAA3’ from Invitrogen) and scramble siRNA (non-targeting pre-designed ID 12935112 ...