Labshake search
Citations for Thermo Fisher :
1 - 50 of 8398 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cell Biology 2022Quote: ... Human NGFR siRNA or negative control siRNA were obtained from ThermoFisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Angptl4-and Angptl3-specific siRNA (Invitrogen) were used at a concentration of 40 nM for 48 h to effectively knock down Angptl4 and Angplt3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The following Human-Silencer Select siRNAs (Thermofisher) were used at a concentration of 20 nM ...
-
bioRxiv - Cell Biology 2024Quote: ... human Kif18A siRNA (Ambion, #Cat 4390825, ID:s37882), human Kif22/Kid siRNA (Ambion ...
-
bioRxiv - Cell Biology 2023Quote: ... Each siRNA from the 33 Silencer™ Human Ion Channel siRNA Library (Invitrogen) was transferred into the Opti-MEM mixture ...
-
bioRxiv - Cancer Biology 2022Quote: ... primary human breast CAFs were transfected with 75 nm human periostin-targeting stealth siRNA (si-POSTN) (ThermoFisher siRNA ID: HSS116400) or 75 nm non-targeting control siRNA (si-Control ...
-
bioRxiv - Cell Biology 2023Quote: Human islets were transfected with 60 nM siRNA targeting human CEBPG (s2901, Silencer Select Pre-designed siRNA, Ambion, Life Technologies), TMEM176A (s226845 ...
-
bioRxiv - Cell Biology 2023Quote: Human islets were transfected with 60 nM siRNA targeting human CEBPG (s2901, Silencer Select Pre-designed siRNA, Ambion, Life Technologies), TMEM176A (s226845 ...
-
bioRxiv - Pathology 2020Quote: ... SMCs were transfected with control siRNA or siRNA targeting the human calpain-2 (Ambion - Silencer Select validated siRNA ...
-
bioRxiv - Biochemistry 2024Quote: ... Human ZIPK-siRNA (am-4390824) and scrambled siRNA (am-AM4613) were purchased from Ambion/Thermofisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: Human Flvcr2 was knocked down in HBEC5i cells using siRNA (Silencer Select siRNA; Ambion). Cells were transfected with either scrambled siRNA or Flvcr2 siRNA using Lipofectamine 3000 (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... SiRNAs targeting human mRNAs were purchased from Invitrogen. SiCDT1 ...
-
bioRxiv - Cell Biology 2024Quote: ... human Kif22/Kid siRNA (Ambion, #Cat 4392420, ID:s7911), human WAPL ON-TARGETplus SMART pool siRNA (J-026287-10-0010 ...
-
bioRxiv - Biochemistry 2021Quote: ... The Silencer™ Select Pre-Designed siRNA for human BAHD1 (Thermo Fisher 4392422, siRNA # s22604) was ordered and used per vendor’s guideline.
-
bioRxiv - Pathology 2020Quote: ... SMCs were transfected with control siRNA or siRNA targeting the human calpain-2 (Ambion - Silencer Select validated siRNA, Thermo Fisher Scientific) sequences using RNAiMax lipofectamine transfection reagent (Life Technologies ...
-
bioRxiv - Genomics 2024Quote: ShP51 cells were transfected with control siRNA (Silencer Select Negative Control #1) or human TSKU siRNA (Silencer Select standard siRNA s24880) from Thermo Fisher Scientific using Lipofectamine RNAiMAX (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... The siRNAs targeting human genes were obtained from Invitrogen and had the following target sequences:
-
bioRxiv - Cancer Biology 2021Quote: ... siRNAs targeting human EP300 (106443) was purchased from Thermofisher.
-
bioRxiv - Biochemistry 2022Quote: ... siRNA targeting human MT1-MMP (Ambion, catalog no. AM51331) or a Negative Control (Invitrogen catalog no ...
-
bioRxiv - Neuroscience 2023Quote: ... siRNA against human Fyn was purchased from Life Technologies Corp ...
-
bioRxiv - Cell Biology 2024Quote: ... or two siRNAs targeting human PLA2G15 (ThermoFisher s24296, s24297) using RNAiMax (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Immunology 2022Quote: ... silencer select siRNA for human FtH1 and negative control siRNA (4392421 and 4390843 respectively, ThermoFisher Scientific) were used ...
-
bioRxiv - Cancer Biology 2024Quote: PXR siRNA (siRNA NR1I2 silencer human, s16909, Life) transfection experiments were performed using Lipofectamine RNAiMax (Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: Predesigned siRNAs for human FXR1 were purchased from Thermo Fisher Scientific Inc. ...
-
bioRxiv - Biochemistry 2022Quote: ... A validated siRNA against the human UCP2 obtained from Ambion (s14630 ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNAs were purchased from Life Technologies (for human cell lines) and from Horizon Discovery (for human PCLS) ...
-
bioRxiv - Biochemistry 2024Quote: ... while human USP18 specific siRNA (#AM16708) was purchased from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: Silencer Select siRNAs against human SNX4 and VPS35, and nontargeting control “scrambled” siRNA (predesigned, 4,390,844) were purchased from Ambion® (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: The siRNA duplex (21 nucleotides) against human cath-D siRNA (ID 4180) was purchased from Ambion (Austin, TX), and the firefly luciferase (Luc ...
-
bioRxiv - Microbiology 2020Quote: ... Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001). The cysteine clamp was introduced in pmCherry N1-HV by exchanging the NheI-PspXI fragment with the corresponding XbaI-PspXI fragment of pET15b-D1D2 -Q68C A396C.
-
bioRxiv - Microbiology 2020Quote: ... Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001). All constructs were verified by DNA sequencing.
-
bioRxiv - Biochemistry 2020Quote: ... The following siRNAs against human rhomboid proteases were purchased from Invitrogen: RHBDL1 #1 ...
-
bioRxiv - Cell Biology 2023Quote: The siRNA targeting human RPA194 was obtained from Invitrogen (cat#: 10620318) as was a negative control siRNA (cat# ...
-
bioRxiv - Cell Biology 2024Quote: ... human custom-made 3’UTR HEC1 siRNA (oligo #3, Thermo Fisher Scientific ...
-
TSG101 Associates with PARP1 and is Essential for PARylation and DNA Damage-induced NF-κB ActivationbioRxiv - Molecular Biology 2021Quote: The screening was performed with a genome-wide siRNA library (Ambion SilencerR Human Genome siRNA library v3, Thermo Fisher), composed of siRNAs targeting approximately 21000 genes arrayed on 384-well plates ...
-
bioRxiv - Cancer Biology 2021Quote: Non-targeting siRNA and siRNA against mouse and human LIG3 were transfected into the cells using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... for activated cells with human PLK1-specific siRNAs (#4390824, s448) and negative control siRNA (#4390846) (Invitrogen, Waltham, Massachusetts, USA) (150 ng/106 cells) ...
-
bioRxiv - Cell Biology 2021Quote: ... ON-TARGET plus human MGEA5 (10724) siRNA-smartpool) or nontargeting siRNA (Dharmacon, ON-TARGETplus nontargeting pool) using Lipofectamine RNAiMAX (Invitrogen) as recommended by the manufacturer ...
-
bioRxiv - Biophysics 2023Quote: ... Clathrin Heavy Chain siRNA (Human CLTC, sequence: GGUUGCUCUUGUUACG, ID: s475) and Negative Control#1 siRNA Silencer Select were purchased from ThermoFisher Scientific.
-
bioRxiv - Cell Biology 2024Quote: Human islets dispersed into single cells from donors without diabetes were transfected with EIF4EBP1 siRNA (Thermo Fisher, siRNA ID s4579) or control siRNA (Accell Non-targeting Control Pool ...
-
bioRxiv - Cell Biology 2024Quote: Reduction of hybrid receptor expression in HUVECs was carried out by transfection of validated human siRNA duplexes of insulin receptor (Silencer™ Pre-Designed siRNA, Invitrogen; Catalog number: AM51331, siRNA ID:29) and IGF-1 receptor (Catalog number ...
-
bioRxiv - Neuroscience 2021Quote: Whole genome Silencer Select Human Genome siRNA Library V4 (Thermo Fisher Scientific), which includes three individual siRNAs targeting each gene (64752 total siRNAs targeting 21.584 human genes ...
-
bioRxiv - Cell Biology 2020Quote: ... were transfected with human myosin VI siRNA duplex (5′GGUUUAGGUGUUAAUGAAGtt-3′) (Ambion) or AllStars Negative Control siRNA duplex (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were transfected with siRNA targeting human Tie1 (s14141 or s14142; Invitrogen) using Lipofectamine RNAiMax (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with 50nM Stealth siRNA against human RXFP1 (Fisher Scientific), 50nM Mission esiRNA against human PTGER2 or PTGER4 (Merck) ...
-
bioRxiv - Cell Biology 2020Quote: Small interfering RNAs (siRNAs) specifically targeting human CD44 (siRNA IDs s2681 and s2682) were obtained from Life Technologies (Carlsbad, CA, USA). DPSCs (1×105 per well ...
-
bioRxiv - Cell Biology 2024Quote: ... human CENP-E ON-TARGETplus SMART pool siRNA (L-003252-00-0010, human custom-made 3’UTR HEC1 siRNA (oligo #3, Thermo Fisher Scientific ...