Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Genetics 2024Quote: Cell pellets (1 x 10^5 – 3 x 10^6) were washed with PBS (Gibco), resuspended in RLB (10 mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2024Quote: ... 6-((acryloyl)amino)hexanoic acid (Acryloyl-X, SE, A-20770, ThermoFisher); Sodium acrylate (408220 ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Physiology 2024Quote: ... / bromo-chloro-indolyl phosphate (Thermo Scientific) in AP buffer or using Naphtol AS-MX phosphate and Fast Red (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 2 mM essential amino acids (Invitrogen), 10 units.ml−1 penicillin ...
-
bioRxiv - Immunology 2022Quote: ... nonessential amino acids (Cellgro) and 2-mercaptoethanol (Gibco). Cells were stimulated with 50 ng/mL PMA plus 100 ng/mL Ionomycin (Cell Stimulation Cocktail ...
-
bioRxiv - Cell Biology 2024Quote: ... 2% MEM Non-Essential Amino Acids (Gibco 11140050), and 25mM HEPES buffer (Gibco 15630080) ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
bioRxiv - Neuroscience 2020Quote: NO production was detected by DAF-FM diacetate (4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate) (D23844, ThermoFisher). Fly larvae were dissected at 24 or 48 h AI in PBS to expose the sensory neurons ...
-
bioRxiv - Microbiology 2024Quote: ... Propidium iodide (PI) and the pH sensitive 2’,7’-Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein (BCECF) (Invitrogen) were added to these at a final concentration of 100µM and 10µM respectively ...
-
bioRxiv - Cancer Biology 2021Quote: ... AEC (3-amino-9-ethyl carbazole) chromogen (Thermo Fisher Scientific) was used ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 5 µg / µl 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) and slides were mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5% Non-Essential Amino Acids (Thermo Fisher Scientific). The use of patient fibroblasts was approved by the Ethics Committees of the Hospital District of Helsinki and Uusimaa (HUS 387/13/03/2009 and HUS/1187/2019) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mL non-essential amino acids (Gibco, Cat# 11140050), 5 mL GlutaMax (Gibco ...
-
bioRxiv - Genetics 2021Quote: ... 5% minimum essential medium nonessential amino acids (100 ×, Gibco), 5% penicillin and streptomycin (Gibco) ...
-
bioRxiv - Genetics 2021Quote: ... 5% minimum essential medium nonessential amino acids (100 ×, Gibco), 5% penicillin ...
-
bioRxiv - Genetics 2021Quote: ... 5% minimum essential medium nonessential amino acids (100 ×, Gibco), 5% penicillin and streptomycin (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% minimum essential medium nonessential amino acids (100×, Gibco), 5% penicillin ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 ml non-essential amino acids (Gibco; 11140-035), 5 ml GlutaMAX (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... n = 3) or oligopyridylamides (5 µM ADH-1 or ADH-6, n = 3) using a combination of both TriZol (Thermo Fisher Scientific) and RNAeasy Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... ATPase activity was assayed by a continuous spectrophotometric method using a 2-amino-6-mercapto-7-methylpurine ribonucleoside–purine nucleoside phosphorylase reaction to detect released inorganic phosphate (EnzChek kit; Thermo Fisher Scientific) (62) ...
-
bioRxiv - Cell Biology 2020Quote: ... then loaded with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethylester (BCECF-AM, 1.6 μM, Life Technologies) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Bioengineering 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Cas. No. 28718-90-3, Thermo Scientific GmbH, Germany), Tween 20 (Art ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: ... Slides were counterstained with 5 μg/mL 4’,6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific) for 10 min at room temperature and washed with 1 × PBST (0.2% Triton-X 100 ...
-
bioRxiv - Immunology 2021Quote: ... + 2 mM Glutamax + 1x non-essential amino acids (Gibco) + 57µM β-Mercaptoethanol (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mL of non-essential amino acids (NEAA) (Gibco), and 400 uL of beta-mercaptoethanol (Life Technologies).
-
bioRxiv - Microbiology 2021Quote: ... Reverse 5’-CGA AGG TGT GAC TTC CATG-3’) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). A standard curve was established in parallel using purified SARS-CoV-2 viral RNA.
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Microbiology 2020Quote: ... 5-(and-6)-carboxyfluorescein (FAM) and 5-(and-6)-carboxytetramethylrhodamine (TAMRA) were obtained from Invitrogen™ ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mL MEM Non-essential Amino Acids (Thermo Fisher Scientific), 1 mL 200 mM ascorbic acid (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 ml 100x non-essential amino acids (Gibco #11140-35), 1 mL 500x β-mercaptoethanol (5mM ...
-
bioRxiv - Immunology 2024Quote: ... 5 mM MEM 140 Non-Essential Amino Acids (NEAA; Gibco), 2mM Glutamax (Gibco) ...
-
bioRxiv - Cell Biology 2024Quote: ... We performed MTT (3-(4,5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) assay (cat no. V13154; Thermo Fisher) for determining cell viability after different tunicamycin treatments as per the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: ... 6′-diamidino-2-phenylindole (Invitrogen). All observations were performed on a Nikon E600 epifluorescence microscope ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...