Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Biochemistry 2022Quote: ... The quality of obtained microsomes was tested with 9-amino-6-chloro-2-methoxyacridine (ACMA; Invitrogen A1324) fluorescence quenching assays.
-
bioRxiv - Immunology 2021Quote: ... The final wash was followed by the addition of Nitro-blue Tetrazolium Chloride/5-bromo-4-chloro 3 ‘indolyl phosphate p-toludine salt (NBT/BCIP chromagen) substrate solution (Thermo Scientific) for 7 min ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein– antibody complexes were visualized using the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium for color development (Life Technologies).
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Developmental Biology 2021Quote: ... 2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]- D-glucose (2-NBDG) (Invitrogen N13195) was used as a probe for monitoring glucose uptake ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Physiology 2024Quote: ... 2-amino-5-methoxybenzoic acid 1 M (ThermoFisher Scientific) in DMSO ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: 4-Amino-5-Methylamino-2’,7’-Difluorofluorescein Diacetate (DAF) (ThermoFisher) was used to measure and spatially resolve nitric oxide (NO ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Bioengineering 2022Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (16:0 NBD) were purchased from Invitrogen. Phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Microbiology 2022Quote: ... Amino acids were extracted on ice-cold lysis buffer [5:3:2 ratio of methanol-acetonitrile-water (Fisher Scientific, Pittsburgh, PA)] containing 3 µM of amino acid standards [Cambridge Isotope Laboratories ...
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Developmental Biology 2020Quote: ... (N-((6-(2,4-DNP)Amino)Hexanoyl)-1-(BODIPY® F C5)-2-Hexyl-Sn-Glycero-3-Phosphoethanolamine) was purchased from Molecular Probes (Melbourne, VIC, Australia). The TiO2 was collected from a disassembled column ...
-
bioRxiv - Immunology 2022Quote: ... membranes were washed three times with PBS-T and then incubated with appropriate secondary antibody conjugated with alkaline phosphatase that provides a visual color change upon addition of the chromogenic substrate (mixture of BCIP (5-bromo-4chloro-3-indolyl phosphate-catalog# 34040) and NBT (nitro-blue tetrazolium chloride, catalog# 34035 from Thermo Scientific)).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Immunology 2024Quote: Two million splenocytes in 200 μl PBS from WT-Foxp3YFPCre/YFPCre and Dgka-/-zf/f-Foxp3YFPCre/YFPCre mice were seeded into a U-bottom 96-well plate in the presence or absence of 100 μM 2-(N-(7-Nitrobenz-2-oxa-1, 3-diazol-4-yl) Amino)-2-Deoxyglucose (2-NBDG; Life Technologies). After incubation at 37°C with 5% CO2 for 30min ...
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in glucose-free media containing 5 μg/ml 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher) and 2.5% FBS at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% nonessential amino acids (Gibco), and 10% FBS (Gibco ...
-
bioRxiv - Molecular Biology 2021Quote: ... We labeled the purified RLC with 10 molar excess of 5-((((2-Iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (IAEDANS, Invitrogen) or dabcyl C2 maleimide (AnaSpec ...
-
bioRxiv - Biochemistry 2024Quote: ... was labeled with the fluorescent probe 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (1,5-IAEDANS from Molecular Probes) as previously described (17 ...
-
bioRxiv - Biophysics 2023Quote: ... covered with sulfosuccinimidyl 6(4-azido-2-nitrophenyl-amino) hexanoate (sulfo-SANPAH) (ThermoFisher Scientific, Loughborough, UK) 0.5 mg/mL in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Neuroscience 2024Quote: ... 2’,7’- Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein, Acetomxymethyl Ester (BCECF-AM, 5 µM) from Invitrogen. All drugs were dissolved in water and added to the standard aCSF except BCECF-AM incubated in Pluronic® F-127 (0.02% ...
-
bioRxiv - Neuroscience 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and immersed and incubated in the dark in staining solution 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronicacid (X-Gluc, Thermo Scientific), 50mM sodium phosphate buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were washed five times with PBS and then twice with distilled water (dH2O) before addition of 5-bromo-4-chloro-3-indolyl-phosphate/NBT (BCIP/NBT) one-step solution (Thermo Fisher Scientific) and incubation at 37°C for approximately 15 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7H11 plates contained 50 μg/mL hygromycin and 50 μM 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) (Thermo Scientific). Unless specified ...
-
bioRxiv - Cell Biology 2023Quote: ... X-biotin-PE [N-((6-(biotinoyl)amino)hexanoyl)-1,2-dihexadecanoylsn-glycero-3-phosphoethanolamine] was obtained from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 - diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...