Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 1 Benzyl 3 Tert Butyldimethylsilyl Oxy Methyl Piperidin 4 One since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... one for virus quantitation (TCID50) and the other for vRNA extraction in TRIzol (ThermoFisher, 15596026; 1 in 3 dilution). Samples were stored at -80°C until required ...
-
bioRxiv - Microbiology 2024Quote: ... at physiological pH before being spun down and resuspended in PBS with the addition of FM 1-43 Dye (N-(3-Triethylammoniumpropyl)-4-(4-(Dibutylamino) Styryl) Pyridinium Dibromide (Cat. no. T3163, Invitrogen). Images were taken on a Zeiss X10 light microscope and cell area was measured using CellProfiler 4.2.1 (33,34).
-
bioRxiv - Molecular Biology 2023Quote: ... stained with N-(3-triethylammonium propyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM 1-43FX, Invitrogen, Cat.-No. F35355) at 5.6 µg ml-1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Caspase-3/7 was quantified using the Apo-ONE® Homogeneous Caspase-3/7 Assay (Promega, Fisher scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... 30 μL of N-methyl-N-trimethylsilyltrifluoroacetamide plus 1% trimethylchlorosilane (MSTFA + 1% TMCS, Thermo Scientific) was added to the MSTFA vials ...
-
bioRxiv - Bioengineering 2024Quote: ... Aqueous 0.85% w/v methyl cellulose was prepared by dissolving powdered methyl cellulose (Thermo Scientific Chemicals ...
-
bioRxiv - Immunology 2020Quote: ... FcMBL was biotinylated at the N terminus of the Fc protein using an N-terminal amino-oxy reaction and then coupled to streptavidin superparamagnetic beads (1µM MyOne Dynabead (Thermo Fisher Scientific, USA). Samples were screened using 5 µg of the FcMBL beads ...
-
bioRxiv - Cell Biology 2024Quote: ... HEKn and N/TERT keratinocytes were routinely cultured in EpiLife medium (ThermoFisher Scientific Cat#MEPI500CA ...
-
bioRxiv - Neuroscience 2023Quote: ... and Tert was used as the reference gene (VIC labeled: ThermoFisher, 4403316).
-
bioRxiv - Cell Biology 2024Quote: ... treating cells with either 400 µM tert-butyl hydroperoxide (TBHP; C10493A, Invitrogen) or 5 mM N-acetyl-L-cysteine (NAC ...
-
bioRxiv - Immunology 2024Quote: ... N/TERT cells were grown in KC-SFM medium (Thermo Fisher Scientific) supplemented with 30 μg/ml bovine pituitary extract ...
-
bioRxiv - Immunology 2024Quote: ... and 3 µg/mL (full dose, or diluted to 1/2, 1/4, 1/8) anti-CD28 (MA110172, Thermo Fisher), and cultured in the pre-coated plate for 3 days ...
-
bioRxiv - Cancer Biology 2022Quote: ... Five million C4-2 or two million SK-OV-3 cells in serum free media were mixed one to one with growth factor reduced Matrigel® (Invitrogen) in a total volume of 200 μl and injected in the hind flank using a 23- or 27-gauge needle ...
-
bioRxiv - Microbiology 2020Quote: ... and 6 μl of the 2X Luna Universal One-Step Reaction Mix was subjected to one-step RT-qPCR using Applied Biosystems QuantStudio 3 (ThermoFisher Scientific), with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Media was changed daily and the cells passaged every 3–4 days at a ratio of 1:4 using the StemPro EZPassage tool (ThermoFisher Scientific).
-
bioRxiv - Neuroscience 2022Quote: ... Then one drop of DAPI (4′, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was added to the suspension and 25 nuclei were sorted by Aria II (BD ...
-
bioRxiv - Immunology 2024Quote: ... One kidney was immersion-fixed in 4% formaldehyde (Thermo Fisher Scientific, 28908), embedded in paraffin ...
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 × 10−3 M GlutaMAX supplement (35050061, Gibco), 2 × 10−4 M L-cystine (C7602 ...
-
bioRxiv - Neuroscience 2021Quote: ... methyl ester (TMRM) (Cat# I34361, Invitrogen) and 1ug/ml Hoechst 33342 (Cat# H3570 ...
-
bioRxiv - Immunology 2021Quote: ... methyl ester (TMRM; Invitrogen cat #T668) in serum-free RPMI media for 45 minutes at 37°C per manufacturer’s protocol.
-
bioRxiv - Biochemistry 2023Quote: ... methyl ester (TMRM, Thermo Fisher Scientific). Cells were loaded with 20 nM TMRM for 30 minutes at 37°C and then transferred to the imaging system ...
-
bioRxiv - Immunology 2023Quote: ... Tetramethylrhodamine methyl ester perchlorate (TMRM, Invitrogen) was used to stain cells at concentrations of 50 or 10 nM ...
-
bioRxiv - Microbiology 2023Quote: ... MES and methyl-salicylate (ACROS Organics); sodium ferulate (Selleck Chemical) ...
-
bioRxiv - Biochemistry 2024Quote: Methyl-β-cyclodextrin (MβCD) (Acros Organics) was used to remove cholesterol from cultured cells ...
-
bioRxiv - Bioengineering 2024Quote: ... 2-methyl-1,3-propanediol (Fisher Scientific), N-methylacetamide (VWR) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Biochemistry 2024Quote: ... as was 7- Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen™ D346) and CPM stock was prepared at 5 mg/mL ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM 4-64; 50 μM) (Invitrogen) or propidium iodide (PI ...
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... Cell monolayers were then stained with 3 mL of overlay containing a 1:1 mixture of 1.2% oxoid agar with 4% neutral red (Gibco) and 2X DMEM with 2% (vol/vol ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Tert-butyl hydroperoxide (TBHP, 70% solution in water) was obtained from Acros Organics and diluted in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK and N/TERT-2G keratinocytes were cultured in EpiLife media (Life Technologies) supplemented with Human Keratinocyte Growth Supplement (HKGS S0015 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and IMR-90 tert (human lung fibroblast) cells were cultured in DMEM (Gibco), supplemented with 10% (v/v ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The transfection reagent was mixed with the pOG44 Flp-Recombinase expression vector and the pCDNA5/TO/FRT-3xMyc-eGFP-CLIP-170 WT or one of the mutant vectors with a 3:1 ratio in Opti-MEMTM I medium (Gibco, ThermoFisher Scientific). Selection started 48h after the transfection in a Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Neuroscience 2022Quote: ... psPAX2 and pMD2.G with a ratio of 4:3:1 in Opti-MEM (Gibco, 31985070) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... with 1 ml per 4 million cells of 3 mM disuccinimidyl glutarate (DSG) (ThermoFisher Scientific, 20593) for 40 min at room temperature and quenched by 0.4 M Glycine for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... 3% sucrose) diluted 1:4 in Leibovitz’s L-15 medium without phenol red (Gibco, Waltham, MA) and an adjusted osmolality of 340 mOsm using 1 M sucrose ...
-
bioRxiv - Genetics 2024Quote: ... with 1 ml per 4 million cells of 3 mM disuccinimidyl glutarate (DSG) (ThermoFisher Scientific, 20593) for 40 min at room temperature and quenched by 0.4 M Glycine for 5 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100 μl of N-methyl-N-trimethylsilyl trifluoroacetamide (MSTFA, Pierce) with 1% trimethylchlorosilane (1% TMCS, Thermo Scientific) was added to react for 30 min in 60°C ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:100 Culture One (ThermoFisher #A33202-01). Depending on the length of the experiment ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Physiology 2022Quote: ... 60 μL of N-methyl-N-trimethylsilyltrifluoracetamide (MSTFA with 1%TMCS, ThermoFisher Scientific #TS48913) was added automatically via the auto sampler and incubated for 30 minutes at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... One-millimeter blocks were fixed in 4% paraformaldehyde (PFA) (Thermo Fisher Scientific # 28908) for two days ...
-
bioRxiv - Genomics 2020Quote: ... Matching regions from 3 adjacent sections were collected on one Capsure Macro Cap (Thermofisher), region size permitting ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were stained for one hour before induction using SP- DiIC18(3) (Invitrogen, #D7777) to fluoresce at 564nm or DiIC18(5 ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was then pegylated for 15 minutes with 2 mM MS(PEG)4 Methyl-PEG-NHS-Ester (ThermoFisher Scientific) before grids.
-
bioRxiv - Cell Biology 2023Quote: ... All chemical inhibitors were diluted in DMSO and were: 3-O-Methyl-Sphingomyelin (SMPD3 inhibitor, Enzo Life technologies, BML-SL225-0005), FAM14 inhibitor (FAK inhibitor ...
-
bioRxiv - Microbiology 2021Quote: ... siDDX42-4: 5’-AUCUCGAAUACCCUUUACG-3’ (ID:136410, Ambion®).