Labshake search
Citations for Thermo Fisher :
1401 - 1450 of 10000+ citations for Human β Amyloid 1 42 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 10% FBS and 1.5 ng/ml β-FGF (Invitrogen).
-
bioRxiv - Immunology 2022Quote: ... and MEF medium was additionally supplemented with 0.1% β-mercaptoethanol (Gibco). THP-1 cells were cultured in RPMI (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... and the housekeeping gene β-actin (TaqMan gene expression assays, ThermoFisher). Cycling conditions were pre-optimized by the supplier ...
-
bioRxiv - Immunology 2021Quote: ... + 1X tissue-culture grade β- mercaptoethanol (Gibco, Catalogue no.-21985-023). On the day of co-culture ...
-
bioRxiv - Immunology 2021Quote: ... + 1X tissue-culture grade β-mercaptoethanol (Gibco, Catalogue no.-21985-023). On the day of co-culture ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-Dodecanoylaminofluorescein Di-β-D-Galactopyranoside (C12FDG, cat#D2893 from ThermoFisher) was added to a final working concentration of 16,66 nM for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-type III β-tubulin (Mouse, 2G10, ThermoFisher Scientific, MA1-118), Anti-MAP2 (Mouse ...
-
bioRxiv - Molecular Biology 2021Quote: ... or the loading control mouse anti-β-tubulin (T8328; Thermo Fisher). Blots were washed and then incubated for 1 hr with 1:10000 goat anti-mouse IgG-HRP (62-6520 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and IFN-β were detected using an ELISA kit (Thermo Scientific) as previously described (26) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 50 μM β-mercaptoethanol (all from Life Technologies, Darmstadt, Germany) containing recombinant murine SCF (100 ng/ml) ...
-
bioRxiv - Cell Biology 2021Quote: ... n-dodecyl-β-D-maltopyranoside (DDM) from Thermo Fisher (Waltham, MA).
-
bioRxiv - Cancer Biology 2021Quote: ... and stained with 5ug/ml of anti-β-catenin antibody (ThermoFisher) overnight at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... ssDNA-anti-β-actin primary antibody (ThermoFisher Scientific cat. no. AM4302) was added to cells at 1:200 dilution in blocking buffer and incubated overnight at 4 °C ...
-
bioRxiv - Biophysics 2022Quote: ... a final concentration of 0.1% n-Octyl-β-D-glucoside (Affymetrix) was added to a 7 µM sample of the PEAK3/14-3-3 complex to limit orientation bias of PEAK3/14-3-3 complex particles ...
-
bioRxiv - Microbiology 2022Quote: ... TGF-β and RANTES using custom ProcartaPlex assay kits (ThermoFisher Scientific). The analyte concentrations were determined using a Luminex 100/200 Flexmap3D instrument coupled with the Luminex XPONENT software.
-
bioRxiv - Biochemistry 2023Quote: ... N-dodecyl β-D- maltoside (DDM,10% stock, Thermo Fisher Scientific) was added to the sample to a final concentration of 1% and the mixture was incubated on ice for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... β-lactamase activity was detected using the ToxBLAzer Dual Screen (Invitrogen), as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... β-lactamase activity was detected using the ToxBLAzer Dual Screen (Invitrogen), as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... UK) and an antibody to β-Actin was obtained from ThermoFisher. Antibodies to hemagglutinin (HA) ...
-
bioRxiv - Immunology 2023Quote: ... Cells were co-stained for β-tubulin (480011, Thermo Fisher Scientific) with signal detected by Alexa Fluor 555 (AF555 ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-β-actin (cat# AM4302 or cat# MA1-744 Thermo Fisher), RNF8 (cat# sc-271462 ...
-
bioRxiv - Immunology 2022Quote: ... 2.5 mM HEPES and 50 µM β-mercaptoethanol (all from Gibco) and divided into unstimulated and stimulated wells ...
-
bioRxiv - Microbiology 2023Quote: ... We used an anti-β actin antibody from ThermoFisher (MA1-140) at 1:5000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and β-Actin monoclonal HRP (Thermo Fisher Scientific MAF-15739-HRP).
-
bioRxiv - Biochemistry 2024Quote: ... 5-(Pentafluorobenzoylamino) Fluorescein Di-β-D-Glucopyranoside (PFB-FDGlu, ThermoFisher Scientific) was used to evaluate GCase activity in live cells ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 2.75 mM β-mercaptoethanol (Thermo Fisher Scientific, 21985-023) and denatured for 5 min at 90° C ...
-
bioRxiv - Immunology 2024Quote: ... 5 mM β-mercaptoethanol and 500 µg/ml G418 sulphate (Invitrogen)) ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... Slides were then incubated with Alexa 594 goat-anti rabbit secondary antibody at 1:750 and with Alexa Fluor 488 goat anti-human IgG(H+L) at 1:500 (both Invitrogen; in PBS) for 2 h at RT.
-
bioRxiv - Neuroscience 2019Quote: ... iPSCs were cultured on a feeder layer of irradiated mouse embryo fibroblasts using human embryonic stem cell media containing DMEM with F12 (DMEM/F12, 1:1 ratio, Thermo Fisher Scientific) supplemented with 20% Knockout Serum Replacer (Thermo Fisher Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mouse lung fibroblasts (CCL-206, ATCC, Wesel, Germany) or human lung fibroblasts (MRC5, ATCC, CCL-171) were cultured in 1:1 DMEM (Gibco, MD, USA) and Ham’s F12 (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were washed three times with PBS and then incubated with either goat anti-human IgG conjugated with Alexa fluor 488 at a dilution of 1:500 for 1 h (Invitrogen, Carlsbad, CA). The cells were then washed and stained with hoechest-33342 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... 2 million cells were activated with dynabeads human T activator CD3/CD28 at a 1:1 bead to cell ratio (Thermo Fisher Scientific), Staphylococcal enterotoxin B (SEB ...
-
bioRxiv - Immunology 2023Quote: ... highly purified (93-98%) naïve human CD4 T cells were activated using anti-CD3+anti-CD28 Dynabeads (1:1, Thermofisher scientific, cat # 11161D) for 8-24 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used (all at 1:100 dilution in immunofluorescence, 1:1000 in immunoblots): CX36 mouse anti-human (Invitrogen, clone 1E5H5), rabbit recombinant ANTI-FLAG M2 antibody (Invitrogen 710662) ...
-
bioRxiv - Cancer Biology 2024Quote: Primary T-cells (CD4 and CD8; 1:1 ratio) were activated for 24 hours with Dynabeads™ Human T-Expander CD3/CD28 (Thermo Fisher) at 3:1 bead ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...